Research Article | Open Access
Eeshita Dhar1, A. Tejashree1 , M.V.S. Krishna Karthik1 and Pushkal Sinduvadi Ramesh2
1Department of Microbiology, JSS Medical college and Hospital, JSS AHER, Mysore, Karnataka, India.
2Center of Excellence in Molecular Biology and Regenerative Medicine (DST-FIST sponsored center), Department of Biochemistry, JSS Medical College, JSS AHER, Mysore, Karnataka, India.
Article Number: 8435 | © The Author(s). 2023
J Pure Appl Microbiol. 2023;17(3):1509-1515. https://doi.org/10.22207/JPAM.17.3.13
Received: 17 January 2023 | Accepted: 28 June 2023 | Published online: 28 July 2023
Issue online: September 2023
Abstract

Staphylococcus aureus strains that are mecA and PBP2a positive but phenotypically susceptible to oxacillin are becoming more and more abundant, according to research from all around the world. The oxacillin susceptibility of Staphylococcus aureus (OS-MRSA) contributes to consequent treatment-failure due to misidentification by conventional susceptibility tests. Therefore, the objective of the current study was to ascertain the prevalence of OSMRSA in a tertiary care facility located in Mysore, South India. 395 MRSA isolates collected from diverse clinical samples were included in this lab-based prospective investigation. These isolates were tested using an oxacillin 1μg disc phenotypically by standard disc diffusion test, and simultaneously MIC to Oxacillin was determined from Vitek2 systems. Additionally, MRSA specific mecA gene detection was applied to these isolates in order to confirm their MRSA status genotypically. PCR findings demonstrate that 65% of the isolates were MRSA. The vitek2 system detected 4.06% OS-MRSA isolates with an oxacillin MIC of ≤2µg/ml. The disc diffusion method identified a total of 13.75% isolates as oxacillin sensitive and 10% isolates were oxacillin intermediately sensitive. Oxacillin sensitivity was shown for 1.87% of the mecA-positive MRSA isolates using the VITEK2 and disc diffusion techniques. This analysis found isolates with lower oxacillin MICs but relatively reduced OS-MRSA incidence. Using an oxacillin disc for routine laboratory MRSA detection might occasionally produce false negative results, which can result in improper antibiotic administration and treatment failure. In order to distinguish OS-MRSA from MRSA, it is crucial to combine phenotypic and genotypic techniques.

Keywords

Oxacillin Sensitive-MRSA (OS-MRSA), mecA Gene, PCR, MRSA, Vitek 2 System, MIC

Introduction

S. aureus is the predominant origin of infections, in the community and in hospital environments. MRSA is also resistant to all other beta-lactam antibiotics, which exacerbates the issue. In October 1960, MRSA initially appeared in hospitals, and then reappeared in 1990 as a community-based illness. MRSA is a significant global health issue that is widespread in hospitals and healthcare facilities across many nations.1

MRSA poses a serious health issue because of its infectiousness, antimicrobial resistance, and presence of virulence factors. The activation of mecA gene, which is encoded on the mobile genetic element staphylococcal cassette chromosome mec (SCCmec), is the main contributor to methicillin resistance in S. aureus (MRSA). The mecA gene encodes a modified penicillin binding protein (PBP2a) with a very low affinity for beta-lactam antibiotics, allowing S. aureus to survive beta-lactam antibiotic treatment. MRSA is defined as Staphylococcus aureus with either the mecA gene or a minimum inhibitory concentration (MIC) of oxacillin greater than 4µg/ml or zone of inhibition ≤10mm by disc diffusion method. There have been reports of S. aureus that are mecA and PBP2a positive but phenotypically sensitive to oxacillin. There is general agreement that these S. aureus isolates should be classified as mecA positive, oxacillin sensitive/susceptible S. aureus (OS-MRSA).2

Furthermore, mecA-positive and oxacillin-sensitive isolates of Staphylococcus epidermidis and Staphylococcus hominis have also been reported. Because PBP2a is induced when these isolates are exposed to -lactams in-vitro, they are referred to as being “cryptically resistant”. Due to their phenotypical vulnerability to oxacillin, they will be misidentified in the normal MRSA screening. These isolates can create a potential concern to patients who, once colonised with one, may soon find themselves colonised or infected with MRSA, for instance during an antimicrobial therapy cycle. The frequency of phenotypic resistance induction brought on by antibiotic exposure and the potential significance of dormant MRSA as a source of hospital acquired infections in both healthcare workers and in-patients.3 Clinical ramifications result from the discovery of OS-MRSA because OSMRSA infections have been suggested in the report Although OS-MRSA is phenotypically responsive to oxacillin, the presence of mecA makes it potentially more susceptible in emergence of highly defiant MRSA under choice of antibacterial agents.2

Materials and Methods

This study was conducted on 395 MRSA isolates collected in the department of microbiology from various clinical samples that included pus, blood, endotracheal aspirates, ear swabs, sputum, urine, and other sterile body fluids, from both in-and-out patients.

Ethical clearance was obtained from the IEC (Institutional Ethics Committee) (JSSMC/IEC/260822/38NCT/2022-23 dated 01-09-2022). All the S.aurues isolates from the clinical samples were processed and identified by standard microbiological methods in the hospital laboratory. Concisely, the clinical isolates were inoculated onto Blood agar (BA) and MacConkey agar for the isolation of the pathogens. Those samples yielded the growth of Staphylococcus aureus that were identified by standard procedures like catalase test, coagulase test and Vitek 2 ID were further included in the study. Resistance patterns of the isolates were documented from Vitek 2 system.

The disc diffusion method (Kirby Bauer) was used to detect methicillin resistance using a cefoxitin 30µg disk. Oxacillin susceptibility was detected by using an oxacillin 1µg disk. S. aureus isolates were lawn cultured onto Muller Hinton agar and the plates were left undisturbed at 37°C overnight after the application of both the antibiotic disk. Strain with the zone of inhibition ≤21mm on MHA around the cefoxitin 30µg (HiMedia) disk and ≤10mm around the Oxacillin disk was considered as MRSA, as per CLSI guidelines 2021. Strain with the zone of inhibition 11-12mm on MHA around the Oxacillin disk was considered intermediate sensitive or borderline resistant, and a zone of inhibition ≥13mm was considered as oxacillin sensitive (Figure 1).

Figure 1. Showing a strain with cefoxitin and oxacillin disk diffusion result on MHA media

MIC data of Oxacillin sensitivity was extracted from automated Vitek2 system. Strains with ≤2µg/ml MIC are considered as oxacillin sensitive and ≥4µg/ml are considered as oxacillin resistant.

Genotypically, MRSA was confirmed by uniplex PCR, a gold standard method, using specific primer sets targeting the mecA gene obtained from Oliveira and de Lencastre (2002), with forward primer mecA F’- TCCAGATTACAACTTCACCAGG and reverse primer mecA R¹- CCACTTCATATCTTGTAACG (162bp).4

DNA Extraction and Amplification: DNA was previously extracted from each S. aureus isolate using the PCI (Phenol-Chloroform-Isoamyl Alcohol) method. The 500µl of lysis buffer (trisHCl+EDTA+NaCl+SDS) and 5µl of proteinase K were added to a 2ml micro-centrifuge tube containing 3 to 4 colonies of S. aureus from a fresh culture media plate and incubated at 56°C for three hours at 50rpm. After Incubation, 500µl of PCI (24:24:1) mixture was added, and centrifuged for 15 minutes at 5000rpm. Transferred the supernatant in 2ml tube and added 500 µl of a chloroform:isoamyl alcohol (24:1) mixture, then centrifuged for 15 minutes at 5000 rpm. Supernatant was collected and mixed with 500µl of sodium-acetate:ethanol (1:9) mixture and kept at -20°C for an hour. After one hour of cold incubation, immediately follow that with 10 minutes of centrifugation at 10,000 rpm, at 4°C. The solution was discarded and 70% ethanol was added and centrifuged at 10000rpm for 10 minutes at 4°C. The tubes were dried at room temperature after the entire fluid was discarded. Elusion buffer was added and spun the tubes before using a nano-drop instrument to measure DNA. All DNA samples that had been extracted were kept at -20°C until being processed.

30µl reaction mixture was prepared for the PCR consisting of the following, Template DNA 1µl, Primers 0.8µl/each (10pmol each primer), Master-mix 7.2µl and Nuclease free water 21.8µl. The PCR amplification was carried out in an automated thermal cycler (Biorad, T100). The cycling conditions were an initial denaturation at 95°Cx5 min, 34 cycles of 95°C x 30sec, 55.7°C x 30s and 72°C x 45sec, followed by a final extension at 72°C x 5 min. All the PCR amplified products were subjected to gel electrophoresis to confirm the presence of the mecA gene. The result was established by gel documentation image, captured by GenSys software.

RESULTS

Among 395 S. aureus isolates, a total of 62.27% (n=246) isolates were identified as MRSA phenotypically by the cefoxitin disk diffusion method. Isolates were collected from various clinical samples such as pus samples (86.17%), blood (3.65%), Et swabs (3.65%), ear swabs (2.84%), sputum (1.6%), urine (0.81%), and other sterile body fluids (1.21%). Only phenotypically identified cefoxitin-resistant S. aureus isolates (MRSA) were considered for oxacillin disk diffusion test and PCR amplification for mecA-gene. A total of 75.6% (n=186) isolates were identified as Oxacillin resistant, 14.63% (n=36) isolates were oxacillin sensitive and 9.75% (n=24) isolates were intermediate sensitive, out of 246 methicillin-resistant S. aureus isolates (Table 1).

Table (1):
Showing total no. Of isolates and their Cefoxitin and oxacillin screening result by Kirby Bauer disk diffusion and Vitek2 system.

Method Cefoxitin screen (No. Of isolates) Oxacillin Screen (No. Of isolates)
Sensitive Intermediate Sensitive Resistant Sensitive Intermediate Sensitive Resistant
Disk diffusion method 149 (37.72%) 246 (62.27%) 36 (14.63%) 24 (9.75%) 186 (75.6%)
Vitek 2 system 395 10  (4.06%) 236 (95.9%)

The polymerase chain reaction technique confirmed a total of 65% (n=160) isolates as MRSA, of which 13.75% (n=22/36) isolates were identified as oxacillin sensitive and 10% (n=16/24) isolates were intermediately sensitive by disk diffusion method. A total of ten (4.06%) isolates showed oxacillin MIC of ≤2µg/ml by the Vitek2 method, of which only six (3.75%) were identified as OS-MRSA by the PCR method. (Table 2) Only three (1.87%;n=3/6) mecA positive isolates were established as oxacillin sensitive by both disc diffusion and the VITEK2 method. (Table 3, Figure 2). Sensitivity and specificity of disk diffusion and Vitek was calculated using two table method and it was found that disk diffusion test to be 64.04% sensitive and 31.34% specific and Vitek showed 76.85% and 23.47%, respectively.

Table (2):
Showing total number of isolates detected as mecA positive MRSA by PCR and their oxacillin susceptibility result.

Oxacillin screen (Disk diffusion method) Oxacillin MIC (Vitek 2 system) mecA positive by PCR method
Sensitive Intermediate Sensitive Resistant Sensitive Intermediate Sensitive Resistant
22

(13.75%)

16

(10%)

122

(76.25%)

6 (3.75%) 154 (96.25%) 160

(65%)

Table (3):
Showing isolates which are oxacillin sensitive-MRSA by both Vitek2 method and Kirby Bauer disk diffusion method.

Oxacillin MIC (Vitek 2 system)
≤0.25µg/ml
0.5µg/ml
2µg/ml
Oxacillin screen (Disk diffusion method)
18mm
11mm
20mm
No. of isolates
1
1
1
Total no. Of OS-MRSA isolates
3 (1.87%)

Figure 2. Showing PCR Amplification of mecA gene (162bp) for MRSA
Lane 1: 50 bp ladder.
Lane 2 & 7: Positive Control & Negative Control for mecA gene of MRSA isolates.
Lane 9-11,14,16: Negative for mecA gene of MRSA isolates.
Lane 3-6,8,12,13,15,17-20: MRSA isolates Positive for mecA gene respectively.

DISCUSSION

Staphylococcus aureus with the mecA gene or a minimum inhibitory concentration (MIC) of oxacillin ≥4µg/ml has been associated with MRSA. However, certain clinical isolates are oxacillin susceptible and mecA-positive. Therefore, we have investigated and found a total of 10 isolates with oxacillin MIC ≤2µg/ml but cefoxitin resistant. A similar result was found in the recent study of Loren Pardo et al., where 27 mecA positive OS-MRSA were reported.5 In another study by Roushan Liu et al., here a total of fourteen OS-MRSA isolates were reported out of 1200 S. aureus by VITEK2 system, oxacillin broth micro-dilution methods, BD Phonenix-100, and all the isolates were verified to be positive with mecA gene. Only 3 isolates out of 14 OS-MRSA isolates were cefoxitin resistant.6

In two different studies from China, reliably higher OS-MRSA isolates were detected in the year 2021. The first study was by Mingbiao Ma et al., in China where oxacillin susceptibility was detected by Vitek 2 automated method and E-test method. A total of 45 OS-MRSA isolates were detected out of a total of 499 S. aureus isolates. The second study was by of Liu J-L et al., in China where they identified a total of 17 OS-MRSA out of 956 S. aureus isolates. In both studies, OS-MRSA isolates were positive for the mecA-gene by PCR method.7,8

The PCR technique confirmed that the mecA-gene was present in a total of 160 isolates in the present study, of which 22 (13.75%) isolates were oxacillin sensitive which is comparable to the study of Tanit Boonsiri et al., reported a total of 43 mecA positive OS-MRSA.9 Similar result found in two different studies in 2019 by Teresa Conceic et al. where 17.7% (n=29/164) were mecA positive OS-MRSA and Sahar Zeinalpour Ahrabi et al., where OS-MRSA found in 6.25% of the students, and all together 54.54% (n=36/60) of the S. aureus isolates were mecA positive and 11.67% of the S. aureus isolates were resistant to oxacillin.10,11

In the study of K. Saeed et al., oxacillin MIC with ≤0.25µg/ml was found in 63% of the clinical isolates, while 32.5 % of isolates had oxacillin MIC values between ≤0.25µg/ml and d”0.5µg/ml for the remaining of isolates, 4.5 % had the MIC ranged between ≤0.5 to ≤1.5µg/ml. Despite overt cefoxitin and oxacillin sensitivities (MIC of ≤0.25µg/ml), six of the isolates (1.2%), while having overt cefoxitin and oxacillin sensitivity (MIC of ≤0.25µg/ml), confirmed positive for the mecA-gene, approving OS-MRSA.12 This result also substantiates the present study, where one isolate was detected with oxacillin MIC ≤0.25µg/ml and another one with 0.5µg/ml. Both the isolates were sensitive to the oxacillin disk diffusion method with the zone of inhibition 18mm and 11mm. This result can also be compared with the study of Marilyn Chung et al., where MRSA strains exhibited low oxacillin MICs ≤0.75µg/ml.13 Another study by V. Anil Kumar et al., also reported 2 MRSA isolates out of 30 S. aureus, which was oxacillin sensitive by Vitek 2 system.14

In our investigation, one OS-MRSA isolate exhibited oxacillin MIC 2µg/ml while also being sensitive to the oxacillin disc diffusion method, which is comparable to the findings of Alexandros Ikonomidis et al., who found that the oxacillin MIC for two isolates with mecA positive was less than 2µg/ml.15 Similar findings were made by Y. Hososaka et al., who reported 57 isolates had an oxacillin MIC of less than 2µg/ml, out of 437 MRSA isolates and presence of mecA-gene was confirmed in six strains by pulse field gel electrophoresis assays.16

CONCLUSION

Since oxacillin susceptible-MRSA is a variation of MRSA, traditional phenotypic approaches based on susceptibility of oxacillin can potentially misidentify OS-MRSA for MSSA. Since OS-MRSA might be present in the collection of S. aureus isolates, we must examine the effectiveness of distinctive detection methods for S. aureus isolates that contain OSMRSA. Although, the extensively used Vitek2 system’s capacity to generate findings faster than other methods, it has been observed a contradiction in distinguishing some of the OS-MRSA in the present analysis. Based on our sensitivity and specificity results, we suggest that even OSMRSA results can be interpreted by Vitek2 as MSSA, hence extra vigilance and confirmatory testing for oxacillin susceptible isolates should be employed in clinical practice due to the incident of OS-MRSA in the oxacillin susceptible population. Cefoxitin has been reflected a more accurate interpreter of the existence of mecA than oxacillin since cefoxitin disc diffusion exhibited notable sensitivity for the identification of Staphylococcus aureus exhibit oxacillin susceptible isolates.

Declarations

ACKNOWLEDGMENTS
The authors would like to thank Administrators of JSSAHER for permitting us to conduct this research and also the teaching staff, Technical Staff and Research Scholars of Centre of Excellence in Molecular and Regenerative Medicine (CEMR) Laboratory, JSSAHER for helping us throughout the study.

CONFLICT OF INTEREST
The authors declare that there is no conflict of interest.

AUTHORS’ CONTRIBUTION
All authors listed have made a substantial, direct and intellectual contribution to the work, and approved it for publication.

FUNDING
None.

DATA AVAILABILITY
All data sets generated or analyzed during this study are included in the manuscript.

ETHICS STATEMENT
This study was approved by the Institutional Ethics Committee, JSS Medical College, JSS AHER, Mysore, Karnataka, India, with reference number JSSMC/IEC/260822/38NCT/2022-23 dated 01-09-2022.

References
  1. Santhanalakshmi P, Mythily N. Screening for MRSA Carriers among Health Care Workers in a Tertiary CareCentre. University Journal of Medicine and Medical Specialities. 2021;7(4).
  2. Pu W, Su Y, Li J, et al. High Incidence of Oxacillin-Susceptible mecA-Positive Staphylococcus aureus (OS-MRSA) Associated with Bovine Mastitis in China. Zhang Q, editor. PloS ONE. 2014;9(2):e88134.
    Crossref
  3. Kampf G, Adena S, R den H, Weist K. Inducibility and potential role of MecA-genepositive oxacillin susceptible Staphylococcus aureus from colonized healthcare workers as a source for nosocomial infections. J Hosp Infect. 2003;54(2):124-129.
    Crossref
  4. Oliveira DC, de Lencastre H. Multiplex PCR strategy for rapid identification of structural types and variants of the mec element in methicillin resistant Staphylococcus aureus. Antimicrob Agents Chemother. 2002:46(7):2155-2161.
    Crossref
  5. Pardo L, Giudice G, Mota MI, et al. Phenotypic And genotypic characterization of oxacillin-susceptible and mecA-Positive staphylococcus Aureus strains Isolated in Uruguay. Rev Argent Microbiol. 2022;54(4):293-298.
    Crossref
  6. Liu R, Zhang J, Du X, et al. Clonal Diversity, Low-Level and Heterogeneous Oxacillin Re-sistance of Oxacillin Sensitive MRSA. Infect Drug Resist. 2021:14 661-669.
    Crossref
  7. Ma M, Chu M, Tao L, et al. First Report of Oxacillin Susceptible mecA-Positive Staphylococcus aureus in a Children’s Hospital in Kunming, China. Infect Drug Resist. 2021;14:2597-606.
    Crossref
  8. Liu JL, Li TM, Zhong N, et al. Current status of oxacillinsusceptible mecA-positive Staphylococcus aureus infection in Shanghai, China: A multicenter study. J Microbiol Immunol Infect. 2021;54(6):1070-1077.
    Crossref
  9. Boonsiri T, Watanabe S, Tan XE, et al. Identification and characterization of mutations responsible for the ²-lactam resistance in oxacillin-susceptible mecA-positive Staphylococcus aureus. Sci Rep. 2020;10(1):16907.
    Crossref
  10. Conceicao T, Coelho C, de Lencastre H, Aires-de-Sousa M. Frequent occurrence of oxacillin-susceptible mecA -positive Staphylococcus aureus (OS-MRSA) strains in two African countries. J Antimicrob Chemother. 2015;70(12):3200-3204.
    Crossref
  11. Ahrabi SZ, Rahbarnia L, Dehnad A, Naghili B, Agdam MHG, Nazari A. Incidence of Oxacillin-Susceptible mecA-Positive Staphylococcus aureus (OSMRSA) Isolates and TSST-1 Virulence Factor Among High School Students in Tabriz, Northwest of Iran. Arch Clin Infect Dis. 2019;14(4). https://brief.land/archcid/articles/85341.html.
    Crossref
  12. Saeed K, Ahmad N, Dryden M, et al. Oxacillin-susceptible methicillin resistant Staphylococcus aureus (OS-MRSA), a hidden resistant mechanism among clinically significant isolates in the Wessex region/UK. Infection. 2014;42(5):843-847.
    Crossref
  13. Chung M, Kim CK, Conceiחדo T, Aires-De-Sousa M, De Lencastre H, Tomasz A. Heterogeneous oxacillin-resistant phenotypes and production of PBP2A by oxacillinsusceptible/ mecA -positive MRSA strains from Africa. J Antimicrob Chemother. 2016;71(10):2804-2809.
    Crossref
  14. Kumar VA, Steffy K, Chatterjee M, et al. Detection of Oxacillin-Susceptible mecA -Positive Staphylococcus aureus Isolates by Use of Chromogenic Medium MRSA ID. J Clin Microbiol. 2013;51(1):318-319.
    Crossref
  15. Ikonomidis A, Michail G, Vasdeki A, et al. In vitro and In vivo Evaluations of Oxacillin Efficiency against mecA -Positive Oxacillin Susceptible Staphylococcus aureus. Antimicrob Agents Chemother. 2008;52(11):3905-3908.
    Crossref
  16. Hososaka Y, Hanaki H, Endo H, et al. Characterization of oxacillinsusceptible mecA-positive Staphylococcus aureus: a new type of MRSA. J Infect Chemother. 2007;13(2):79-86.
    Crossref

Article Metrics

Article View: 8276

Share This Article

© The Author(s) 2023. Open Access. This article is distributed under the terms of the Creative Commons Attribution 4.0 International License which permits unrestricted use, sharing, distribution, and reproduction in any medium, provided you give appropriate credit to the original author(s) and the source, provide a link to the Creative Commons license, and indicate if changes were made.