ISSN: 0973-7510
E-ISSN: 2581-690X
, Miseon Sung1, Jung Hoan Kim3 and Yohan Yoon1,2 The demand for hygiene products has increased worldwide since the outbreak of global COVID-19. As the hygiene products market is expanding, it is necessary to manage microbial contamination in wet towels and wet wipes. This study evaluated pretreatment methods for microbial recovery from wet towels and wipes and microbial contamination levels in wet towels and wipes with the pretreatment method. Escherichia coli (NCCP14038 and NCCP14039), Staphylococcus aureus (ATCC25923 and ATCC29213), and Pseudomonas aeruginosa (NCCP10250 and NCCP11229) were inoculated on five fabric materials of wet towels and wet wipes. The recovery rates of the bacteria from wet towels and wet wipes using three pretreatment methods (pummeling, hand shaking, and portion cutting method) were investigated. Using the selected pretreatment method, the contamination levels of E. coli, S. aureus, and P. aeruginosa were evaluated for 238 wet towels and 244 wet wipes, which were collected in April to August, 2019. The presence of toxA and antibiotic resistance of P. aeruginosa isolated from wet towels were evaluated. The overall recovery rates of the pummeling method and hand shaking method were higher than the portion cutting method. Considering the convenience, the pummeling method was used to investigate the microbial contamination in the wet towels and wet wipes. P. aeruginosa was detected in two wet towels at an average of 9.9×102 CFU/towel. E. coli and S. aureus were not detected in both wet towels and wipes. P. aeruginosa isolates showed no resistances to piperacillin, piperacillin-tazobactam, aztreonam, and gentamicin, but had toxA. The results indicate that the pummeling method is the most appropriate pretreatment method for the recovery of microorganisms, and microbial analysis showed that this method could be useful in monitoring microbial contamination in wet towels and wet wipes.
Wet Towels, Wet Wipes, Hygiene Products, Pretreatment Method, Microbial Contamination
As the level of awareness about food safety and the amount of eating-out increases, the consumption of hygiene products also increases.1 In addition, consumption of hygiene products such as wet towels and wet wipes has increased since the outbreak and spread of COVID-19.2-4 Escherichia coli and Staphylococcus aureus are often isolated from human hands.5,6 E. coli is Gram-negative bacteria, and contamination is spread through direct contact between hands and surfaces.7,8 S. aureus can cause contamination through lesions on the hands or arms of workers or through coughing.9 Because a few S. aureus isolates produce enterotoxins, the growth and proliferation of S. aureus present a potential risk to consumer health.10 As Pseudomonas aeruginosa is ubiquitous in nature, the frequency of contact with humans is relatively high.11 It is resistant to many antibiotics, and thus, the infection is very difficult to treat.12 Exotoxin A produced by P. aeruginosa, can cause diseases in humans through the inhibition of protein synthesis, cellular degeneration, and interference with the immune function of host cells.13 As such, there is a possibility of being exposed to diseases due to the use of wet towels and wet wipes. In addition, wet wipes consist of several fabrics, including natural and synthetic fibers.14 Because Korea does not suggest pretreatment methods for the microbial test of wet towels and wet wipes in detail, the pretreatment methods to increase the recovery rates of microorganisms contaminated with samples of various fabrics should be prepared. Therefore, the objective of this study was to evaluate pretreatment methods and evaluate microbial contaminations in wet towels and wet wipes with the selected pretreatment method.
Comparison of pretreatment methods
Selection pretreatment methods
The materials used in wet towels and wet wipes were investigated in the literature, applicable experimental pretreatment methods were selected, and bacterial recovery rates according to the pretreatment method were compared for each material. For the pummeling method, entire sheets of wet towel (15-25 g) or wet wipes (10-25 g) were placed in sample bags (3M, Maplewood, MN, USA), and they were 10-fold diluted with 0.1% buffered peptone water (BPW; BD Difco, Sparks, MD, USA) of the sample weight and homogenized by pummeler (BagMixer, Interscience, St. Nom, France) for 3 min. For the hand shaking method, 0.1% BPW was added to a sample bag (3M, USA) at a 10-fold dilution of the sample weight, and the sample bag was shaken by hand for 3 min. For portion cutting method, 2 g of hygiene products made of textile materials and 100 mL of distilled water were placed in a sample bag (3M, USA), and the sample bag was shaken using a rocker (RF300, ForBioKorea Co., Ltd., Gyeonggi, Korea) for 2 h.
Preparation of inocula and inoculation
Isolated colonies of E. coli strains NCCP14038 and NCCP14039 on MacConkey agar (BD Difco), or isolated colonies of S. aureus strains ATCC25923 and ATCC29213 on Baird-Parker agar (BPA; Oxoid Ltd., Basingstoke, Hants, UK) were inoculated in 10 mL of tryptic soy broth (TSB; BD Difco). They were cultured at 35°C for 24 h. Isolated colonies of P. aeruginosa strains NCCP10250 and NCCP11229 on cetrimide agar (BD Difco) were inoculated in Luria-Bertani broth (LB broth; BD Difco). It was cultured at 35°C for 24 h. Aliquots (0.1 mL) of E. coli or S. aureus cultures were transferred into 10 mL TSB, and an aliquot (0.1 mL) of P. aeruginosa culture was transferred into 10 mL LB broth. The cells were then subcultured at 35°C for 24 h. After the incubation, the subcultures of each bacterial strain were mixed and centrifuged at 1,912×g and 4°C for 15 min, and the cell pellets were washed twice with phosphate buffered saline (PBS, pH 7.4; NaCl 8.0 g, NaHPO4 1.5 g, KH2PO4 0.2 g, KCl 0.2 g in 1 L distilled water). The cell suspensions were then diluted with PBS at 5-6 log CFU/mL and used for the inocula.
Inoculation and evaluation for bacterial cell recovery
For wet towels, cotton (24 cm × 24 cm, 15 g) without antimicrobials used were examined because only cotton is used for the wet towel. For wet wipes, four materials [rayon (20 cm × 15 cm, 2 g), pulp (20 cm × 15 cm, 3 g), lyocell (20 cm × 15 cm, 3 g), and spunlace nonwoven (20 cm × 15 cm, 3 g)] were examined. These materials were sterilized at 121°C for 15 min. The aliquots (1 mL) of E. coli, S. aureus, or P. aeruginosa inocula were inoculated on the wet towels and wet wipes samples in filter bags. The samples were rubbed to spread the bacterial cells out with hands for 3 min. The samples were then treated with the pummeling, hand shaking, and portion cutting methods. The homogenates from the three methods were serially diluted with 0.1% BPW, and 0.1-mL aliquots of the diluents were spread-plated on MacConkey agar (BD Difco) for E. coli, BPA (Oxoid Ltd.) for S. aureus, and cetrimide agar (BD Difco) for P. aeruginosa. The plates were then incubated at 35°C for 24 h. After incubation, the typical colonies were counted manually. The recovery rate was calculated as follows:
Recovery Rate (%) = [ No. of Bacteria after Pretreatment (CFU/g) / No. of Inoculated Bacteria (CFU/g) ] X 100
Investigation of microbial contamination level
Sample preparation
A total of 238 wet towels (24 cm × 28 cm, 15-25 g) and 244 wet wipes (20 cm × 15 cm, 5-15 g) were collected from restaurants or online shops from April to August in 2019. The collected samples were placed in an ice cooler and then transported to a laboratory within 4 h. According to the sample preparation procedure for hygiene products, a whole sheet of wet towel and wet wipe was aseptically placed into a filter bag and 10-fold diluted with 0.1% BPW (BD Difco) of the sample weight. The samples were homogenized with the pretreatment method test. The homogenized samples were then subjected to microbial analysis.
E. coli
Aliquots (1 mL) of the homogenates for wet towels and wet wipes were placed in EC Petrifilm (3M) and spread out for E. coli enumeration. The petrifilms were incubated at 35°C for 24 h, and red colonies with air bubbles were counted manually for detection E. coli. Also, 1-mL aliquotes of the homogenates were cultured in 10 mL of EC broth (BD Difco) containing Durham fermentation tubes at 35°C for 24 h. One loopful of the culture medium of the gas-generation positive sample was streaked on eosin methylene blue agar (EMB agar; BD Biosciences). After incubating the plate at 35°C for 24 h, the presence of greenish metallic sheen in light, a typical colony of E. coli, was confirmed.
S. aureus
For qualitative analysis, aliquots (1-mL) of the homogenates were inoculated into 9 mL of TSB plus 10% NaCl and enriched at 35°C for 24 h. A loopful of the enriched cultures was streaked on BPA (Oxoid Ltd.). The plates were incubated at 35°C for 24 h. Glossy black colonies surrounded by clear zones were identified as S. aureus. For quantification, aliquots (1 mL) of the homogenates were spread evenly in BPA (Oxoid Ltd.) for complete absorption and then incubated at 35°C for 24 h. Afterward, typical colonies were manually counted.
P. aeruginosa
Aliquots (1 mL) of the homogenates were inoculated in 9 mL of TSB (BD Difco) and incubated at 35°C for 24 h for enrichment. The enriched media were streaked on cetrimide agar (BD Difco), and the plates were incubated at 35°C for 24 h. Four colonies with green fluorescence in the plates were selected, and 16s rRNA was analyzed for identification. The proportion of positive colonies was multiplied by the number of colonies in the plates for P. aeruginosa cell counts. For DNA extraction, a colony was taken from cetrimide agar plates and suspended in a 1.5-mL microcentrifuge tube (Axygen Inc., New York, USA) containing 100 μL sterile distilled water. It was heated in a heat block at 99°C for 10 min, centrifuged at 15,814×g for 3 min, and the supernatant was used as template DNA. The universal bacterial 16s rRNA primers 27F (5’–AGA GTT TGA TCM TGG CTC AG–3’) and 1492R (5’–CGG TTA CCT TGT TAC GAC TT–3’)15 were used for identification with 16s rRNA sequencing. The PCR product mixture was amplified with modified cycling conditions [95°C for 4 min (initial denaturation), 30 cycles of 95°C for 30 sec (denaturation), 55°C for 40 sec (annealing), and 72°C for 1 min (extension)] using Rotor-Gene Q (Qiagen).15 Fluorescence-labeled ddNTP was added to the PCR product using a BigDye Terminator v3.1 matrix standard kit (ThermoFisher Scientific). Sequencing was performed with Applied Biosystems 3730 DNA Analyzer (Thermo Fisher Scientific). The homology of the isolates was compared by the BLAST search program of NCBI (https://blast.ncbi.nlm.nih.gov/Blast.cgi). For quantitative analysis, aliquots (1 mL) of homogenates were spread-plated evenly on cetrimide agar (BD Difco). The plates were incubated at 35°C for 24 h. Colonies with green fluorescence on the plates were counted manually.
Characterization of isolated P. aeruginosa
Identification of pathogenic genes
PCR was used to detect the toxin-generating gene (toxA) in P. aeruginosa colonies, which were determined to be positive in the qualitative test. For DNA extraction, a colony was taken from cetrimide agar plates and suspended in a 1.5-mL microcentrifuge tube containing 100 μL of sterile distilled water. It was heated in a heat block at 99°C for 10 min, centrifuged at 15,814×g for 3 min, and the supernatant was used as template DNA. DNA was extracted from two cultured P. aeruginosa isolates and used as template DNA, and the primers presented in Table 1 were used to amplify the toxA gene. The initial denaturation at 94°C for 5 min, denaturation at 94°C for 1 min, annealing at 62.4°C for 1 min, and extension at 72°C for 1 min, was repeated 30 times, followed by a final extension at 72°C for 10 min,16 after which the PCR reaction was terminated. The PCR product was electrophoresed on a 1.5% agarose gel, and the bands were visualized by a UV-transilluminator (Vilber Lourmat, Collégien, France).
Table (1):
Primer sequences for toxA gene amplification of Pseudomonas aeruginosa.
| Gene | Sequence (5’ to 3’) | Size (bp) | Reference | |
|---|---|---|---|---|
| toxA | Forward | GGTAACCAGCTCAGCCACAT | 352 | Khattab et al., 201516 |
| Reverse | TGATGTCCAGGTCATGCTTC |
Examination of antibiotic resistance
To examine the antibiotic resistance of the P. aeruginosa isolates having toxA gene, the antibiotic diffusion method was used according to the ‘performance standards for antimicrobial susceptibility testing’ of the Clinical and Laboratory Standards Institute (CLSI).17 E. coli ATCC43887 was used as a control according to CLSI, and one isolate with toxA per sample was selected, and P. aeruginosa isolates were spread evenly on Mueller-Hinton agar (MHA; BD Difco, USA) with sterile cotton and dried for 5 min. Antibiotic discs (piperacillin 100 μg, piperacillin-tazobactam 100/10 μg, aztreonam 30 μg, and gentamicin 10 μg) were then placed on the plates and incubated at 35°C for 24 h. Diameters of the inhibition zones around the antibiotic discs were measured after incubation, and the antibiotic resistance was determined according to the performance standards for antimicrobial susceptibility testing.17
Statistical analysis
Experimental data were analyzed using a pairwise t-test with the general linear procedure of SAS® version 9.4 (SAS Institute Inc., Cary, NC, USA) to determine significant differences (p<0.05) in the mean values among the different pretreatment methods.
Selection of pretreatment method
In general, the portion cutting method had a lower (p<0.05) cell recovery rate than the pummeling and hand shaking methods (Table 2). In cotton, rayon, and lyocell materials, E. coli and S. aureus had higher (p<0.05) cell recovery rates by the hand shaking method than the portion cutting method, and P. aeruginosa had a higher (p<0.05) cell recovery rate using the pummeling method than the portion cutting method. In pulp materials, more E. coli was recovered by the pummeling method than hand shaking method, but the difference was not significant. In addition, the cell recovery rates of S. aureus and P. aeruginosa using the hand shaking method were higher than those using the pummeling method, but the difference was not significant. In spunlace nonwoven materials, E. coli and P. aeruginosa had higher recovery rates by the pummeling method than the hand shaking method, and S. aureus had high recovery rates by the hand shaking method than the pummeling method, but the difference was not significant. Regardless of the material types, the pummeling and hand shaking methods had higher recovery rates than the portion cutting method, and both methods had similar recovery rates. The hand shaking method may induce variation in recovery rates by individuals. Thus, the pummeling method was selected for further analyses.
Table (2):
Bacterial cell recoveries from various material used for wet towels and wet wipes after pretreatments.
Bacteria |
Material |
Pretreatment method |
No. of inoculated bacteria (CFU/g) |
No. of bacteria after pretreatment (CFU/g) |
Recovery rate (%) |
|---|---|---|---|---|---|
E. coli |
Cotton |
Pummeling |
9.1×103 |
5.3×103 |
48.5c |
Hand shaking |
6.7×103 |
59.3bc |
|||
Portion cutting |
2.5×103 |
23.0e |
|||
Rayon |
Pummeling |
3.9×104 |
3.8×104 |
82.2a |
|
Hand shaking |
3.9×104 |
87.0a |
|||
Portion cutting |
2.3×104 |
48.0c |
|||
Lyocell |
Pummeling |
7.3×104 |
6.8×104 |
82.2a |
|
Hand shaking |
7.1×104 |
83.5a |
|||
Portion cutting |
3.5×104 |
43.6cd |
|||
Pulp |
Pummeling |
6.0×104 |
5.3×104 |
79.9ab |
|
Hand shaking |
5.2×104 |
77.3ab |
|||
Portion cutting |
3.3×104 |
49.8c |
|||
Spunlace |
Pummeling |
4.3×104 |
4.2×104 |
86.6a |
|
nonwoven |
Hand shaking |
3.5×104 |
75.3ab |
||
Portion cutting |
1.8×104 |
44.3cd |
|||
S. aureus |
Cotton |
Pummeling |
2.5×103 |
1.4×103 |
57.4bc |
Hand shaking |
1.5×103 |
61.0bc |
|||
Portion cutting |
8.0×102 |
28.8de |
|||
Rayon |
Pummeling |
9.7×103 |
7.6×103 |
80.0ab |
|
Hand shaking |
8.1×103 |
83.1a |
|||
Portion cutting |
3.1×103 |
34.0de |
|||
Lyocell |
Pummeling |
1.6×104 |
1.3×104 |
84.7a |
|
Hand shaking |
1.4×104 |
85.7a |
|||
Portion cutting |
6.0×103 |
35.5cd |
|||
Pulp |
Pummeling |
1.5×104 |
1.1×104 |
73.6ab |
|
Hand shaking |
1.2×104 |
79.5ab |
|||
Portion cutting |
7.6×103 |
49.4c |
|||
Spunlace |
Pummeling |
9.1×103 |
6.7×103 |
76.9ab |
|
nonwoven |
Hand shaking |
7.6×103 |
82.9a |
||
Portion cutting |
4.6×103 |
45.9cd |
|||
P. aeruginosa |
Cotton |
Pummeling |
5.5×103 |
2.5×103 |
48.0c |
Hand shaking |
2.7×103 |
44.3cd |
|||
Portion cutting |
1.4×103 |
24.7de |
|||
Rayon |
Pummeling |
2.4×104 |
1.9×104 |
78.4ab |
|
Hand shaking |
1.6×104 |
69.0b |
|||
Portion cutting |
1.2×104 |
44.6cd |
|||
Lyocell |
Pummeling |
3.1×104 |
2.4×104 |
80.4a |
|
Hand shaking |
2.3×104 |
78.5ab |
|||
Portion cutting |
1.2×104 |
34.3de |
|||
Pulp |
Pummeling |
3.6×104 |
2.5×104 |
67.8b |
|
Hand shaking |
2.5×104 |
69.5b |
|||
Portion cutting |
2.1×104 |
57.2bc |
|||
Spunlace |
Pummeling |
1.9×104 |
1.6×104 |
85.5a |
|
nonwoven |
Hand shaking |
1.4×104 |
75.8ab |
||
Portion cutting |
5.4×103 |
31.1de |
|||
a-e Values are significant different in different pretreatment method (p<0.05)
Application of selected pretreatment method for monitoring
Of 238 wet towels, P. aeruginosa was identified in two samples (0.8%), and the average detection level was 9.9×102 CFU/towel. However, E. coli and S. aureus were not detected in any sample. Even though E. coli and S. aureus were not detected, if microorganisms may remain owing to insufficient hygiene management by workers or insufficient washing in the wet towel production stage. Microorganisms may multiply during storage at room temperature in a factory after wet towels are packaged, or during delivery in a vehicle. In addition, if individual package of wet towels is removed and stored in restaurant, cross-contamination may occur among wet towels. Therefore, the wet towel should be stored at cold temperatures and the delivery vehicle should have refrigeration system. In addition, in restaurants, the individual package should be kept from the consumer use. E. coli, S. aureus, and P. aeruginosa were not detected in 244 wet wipes.
Pathogenic gene and antibiotic resistance of P. aeruginosa isolates
Exotoxin A is a virulence factor of P. aeruginosa in clinical infections that can cause tissue and organ damage.18 The toxA gene regulates exotoxin A synthesis.19 In two wet towel samples, P. aeruginosa was detected at an average level of 9.9×102 CFU/towel. The colonies were analyzed to detect toxA gene by PCR analysis, and the isolates had toxA gene. It indicates that the P. aeruginosa isolates could be pathogenic.
Table (3):
Clear zone sizes (mean ± standard deviation; mm) of Pseudomonas aeruginosa isolated from wet towels against antibiotics.
Classification |
Penicillins Piperacillin (100 μg) |
β-lactams Piperacillin-tazobactam (100/10 μg) |
Monobactams Aztreonam (30 μg) |
Aminoglycoside Gentamicin (10 μg) |
|---|---|---|---|---|
Resistance limit |
≤14.0 |
≤14.0 |
≤15.0 |
≤12.0 |
Control (E. coli ATCC43887) |
34.5±0.7 |
33.5±0.7 |
40.0±0.0 |
23.0±0.0 |
P. aeruginosa SMFM201908-WT1 |
34.7±0.6 |
34.3±2.1 |
26.7±2.5 |
24.7±1.2 |
P. aeruginosa SMFM201908-WT49 |
31.7±1.2 |
32.3±1.2 |
27.7±1.2 |
21.2±1.5 |
P. aeruginosa is generally resistant to penicillin, β-lactams, monobactams, and aminoglycan antibiotics.20,21 Thus, in the present study, antibiotic resistance tests were conducted for four antibiotics most effective on P. aeruginosa. Two P. aeruginosa isolates did not resist the antibiotics (Table 3). P. aeruginosa is a non-fermenting, gram-negative bacillus that occurs widely in the natural environment, and most strains are opportunistic pathogens that rarely cause diseases in humans.22 Because P. aeruginosa is a common flora on human skin,23 P. aeruginosa contamination might occur due to poor personal hygiene during the wet towel packaging. There were also cases of microbial contamination by bare hands during the manufacturing and packaging of wet towels.24 P. aeruginosa can cause skin diseases, leading to keratitis and peritonitis.23,25 Although P. aeruginosa isolates do not have antibiotic resistance, if the P. aeruginosa isolates possessing toxA gene infect the immune-compromised, it might cause pathogenicity.
Among the pretreatment methods used in this study, there was no noticeable difference between the pummeling method and the hand shaking method, and the portion cutting method was inefficient in recovering bacteria. With the pummeling method, only P. aeruginosa was detected in two wet towels, and P. aeruginosa, S. aureus and E. coli were not detected in wet wipes. In addition to the existing pretreatment test methods, it may be necessary to develop a new pretreatment method that can increase the recovery rates of microorganisms from wet towels and wet wipes in the future study.
ACKNOWLEDGMENTS
The authors would like to thank Ministry of Food and Drug Safety for their support.
CONFLICT OF INTEREST
The authors declare that there is no conflict of interest.
AUTHORS’ CONTRIBUTION
All authors listed have made a substantial, direct, and intellectual contribution to the work, and approved it for publication.
FUNDING
This study was funded by the Ministry of Food and Drug Safety under Grant (19162MFDS017).
DATA AVAILABILITY
The datasets generated and/or analysed during the current study are available from the corresponding author on reasonable request.
ETHICS STATEMENT
Not applicable.
- Kolanowski W, Karaman AD, Akgul FY, Lugowska K, Trafialek J. Food safety when eating out – perspectives of young adult consumers in Poland and Turkey – a pilot study. Int J Environ Res Public Health. 2021;18(4):1884.
Crossref - Chong MS. Bacterial contamination in disposable wet wipes from general restaurants [Korean]. Korean J Clin Lab Sci. 2016;48(3):237-241.
Crossref - Koksoy Vayisoglu S, Oncu E. The use of cleaning products and its relationship with the increasing health risks during the COVID-19 pandemic. Int J Clin Pract. 2021;75(10):e14534.
Crossref - Hu T, Shen M, Tang W. Wet wipes and disposable surgical masks are becoming new sources of fiber microplastic pollution during global COVID-19. Environ Sci Pollut Res. 2022;29: 284–292.
Crossref - Abd-Elaleem R, Bakr WMK, Hazzah WA, Nasreldin O. Assessment of the personal hygiene and the bacteriological quality of butchers’ hands in some abattoirs in Alexandria, Egypt. Food Control. 2014;41:147-150.
Crossref - Tan SL, Lee HY, Mahyudin NA. Antimicrobial resistance of Escherichia coli and Staphylococcus aureus isolated from food handler’s hands. Food Control. 2014;44:203-207.
Crossref - King MF, López-García M, Atedoghu KP, Zhang N, Wilson AM, Weterings M, Hiwar W, Dancer SJ, Noakes CJ, Fletcher LA. Bacterial transfer to fingertips during sequential surface contacts with and without gloves. Indoor Air. 2020;30:993-1004.
Crossref - Rusin P, Maxwell S, Gerba C. Comparative surface-to-hand fingertip-to-mouth transfer efficiency of gram-positive bacteria, gram-negative bacteria, and phage.
J Appl Microbiol. 2002;93:585-592.
Crossref - Kluytmans JAJW, Wertheim HFL. Nasal carriage of Staphylococcus aureus and prevention of nosocomial infections. Infection. 33:3-8.
Crossref - Mahros MA, Abd-Elghany SM, Salla KI. Multidrug-, methicillin-, and vancomycin-resistant Staphylococcus aureus isolated from ready-to-eat meat sandwiches: An ongoing food and public health concern. Int J Food Microbiol. 2021;346:109165.
Crossref - Ramsey MM, Whiteley M. Pseudomonas aeruginosa attachment and biofilm development in dynamic environments. Mol Microbiol. 2004;53(4):1075-1087.
Crossref - Bonomo RA, Szabo D. Mechanisms of multidrug resistance in Acinetobacter species and Pseudomonas aeruginosa. Clin Infect Dis. 2006;43(Suppl. 2):S49-S56.
Crossref - Pollack M. The role of exotoxin A in pseudomonas disease and immunity. Rev Infect Dis. 1983;5(Suppl. 5):S979-S984.
Crossref - Köklü R, Ateş A, Deveci EÜ, Sivri N. Generic foresight model in changing hygiene habits with the pandemic: use of wet wipes in next generations. J Mater Cycles Waste Manag. 2023;25(1):74-85.
Crossref - Raja CE, Pandeeswari R, Ramesh U. Characterization of high fluoride resistant Pseudomonas aeruginosa species isolated from water samples. Environ Res Tec. 2022;5(4):325-339.
- Khattab MA, Nour MS, ElSheshtawy NM. Genetic identification of Pseudomonas aeruginosa virulence genes among different isolates. J Microb Biochem Technol. 2015;7(5):274-277.
- Clinical and Laboratory Standards Institute. Performance standards for antimicrobial susceptibility testing. 26th ed. CLSI supplement M100S. Clinical and Laboratory Standards Institute, Pennsylvania. 2016.
- Jenkins CE, Swiatoniowski A, Issekutz AC, Lin TJ. Pseudomonas aeruginosa exotoxin A induces human mast cell apoptosis by a caspase-8 and -3-dependent mechanism. J Biol Chem. 2004;279(35):37201-37207.
Crossref - Dong D, Zou D, Liu H, Yang Z, Huang S, Liu N, He X, Liu W, Huang L. Rapid detection of Pseudomonas aeruginosa targeting the toxA gene in intensive care unit patients from Beijing, China. Front Microbiol. 2015;6:1100.
Crossref - Pang Z, Raudonis R, Glick BR, Kin TJ, Cheng Z. Antibiotic resistance in Pseudomonas aeruginosa: mechanisms and alternative therapeutic strategies. Biotechnol Adv. 2019;37(1):177-192.
Crossref - Glen KA, Lamont IL. β-lactam resistance in Pseudomonas aeruginosa: current status, future prospects. Pathogens. 2021;10(12):1638.
Crossref - Diggle SP, Whiteley M. Microbe profile: Pseudomonas aeruginosa: opportunistic pathogen and lab rat. Microbiol. 2020;166(1):30-33.
Crossref - Spernovasilis N, Psichogiou M, Poulakou G. Skin manifestations of Pseudomonas aeruginosa infections. Curr Opin Infect Dis. 2021;34(2):72-79.
Crossref - Ministry of Food and Drug Administration. Investigation of contamination status among hygiene products [Korean]. 2021. https://scienceon.kisti.re.kr/commons/util/originalView.do. Accessed 25 Oct 2021.
- Cole N, Krockenberger M, Stapleton F, Khan S, Hume E, Husband AJ, Willcox M. Experimental Pseudomonas aeruginosa keratitis in interleukin-10 gene knockout mice. Infect Immun. 2003;71(3):1328-1336.
Crossref
© The Author(s) 2023. Open Access. This article is distributed under the terms of the Creative Commons Attribution 4.0 International License which permits unrestricted use, sharing, distribution, and reproduction in any medium, provided you give appropriate credit to the original author(s) and the source, provide a link to the Creative Commons license, and indicate if changes were made.