Open Access

Nawar Jaber Hussein Al-Asadi and Russul Wassit Kadhum

Department of Biology, College of Science, Wasit University, Kut, Iraq.
J Pure Appl Microbiol. 2018;12(2):827-832
https://doi.org/10.22207/JPAM.12.2.44 | © The Author(s). 2018
Received: 10/02/2018 | Accepted: 24/03/2018 | Published: 30/06/2018
Abstract

Giardia lamblia is considered one of the most common intestinal pathogens worldwide which cause gastroenteritis in human and animal. The purpose of the present study was to determine the prevalence and the most genotype that common of G. lamblia in the Wasit province, Iraq. A total of 50 stools samples have been collected from patient’s that suffering from severe diarrhea from hospitals Al-Zahraa and Al-Karama in Wasit province, Iraq during the period from May 2016 to September 2016.  The results showed 36 (72%) was positive, while 14 (28%) was negative by Nested PCR technique. Then amplification by Nested PCR has been made to observe the most genotype frequent which common, the results showed 8 (22%) contained genotyping A genotyping and B 28 (78%) contained genotype B. In this study molecular techniques played a significant role in the detection, epidemiological reconnaissance and outbreak studies.

Keywords

Giardia lamblia, Genotyping, Giardiasis

Introduction

Giardia lamblia is an intestinal protozoan parasite which causing diarrheal disease in human worldwide (Adam, 2001; Berkman et al., 2001; Fricker et al., 2001; Karanis et al., 2006) about 280 million are infected with Giradia each year in the world (Ortega YR et al., 2013). This parasite has been observed firstly by van Leeuwenhoek in 1681 through checked his own stool sample under microscope (Ankarklev J et al., 2010), Giardiasis which causing by Giardia lamblia is a wide spreading in Asia, Africa and Latin America whereas, about 200 million persons have been reported (Mohammed et al., 2009) The contaminated food or water with oocysts, as well as fecal-oral route from person to person (Balcioglu et al., 2003), among children in schools, (Duffy T et al., 2013) and by sexual practices of adults (Pakianathan et al., 1999 ; Escobedo et al., 2014) are the main ways to transmission Giardia lamblia. The oocysts have the ability to be infectious for few months and they can acclimatize to or resist critical environmental conditions (Duffy T et al., 2013). The clinical manifestation of Giardiasis is absorption, watery stools, dehydration and abdominal cramping (Adam, 2001; Amar et al., 2002; Bertrand et al., 2005). Giardiasis in generally is self-limiting in healthy individuals and in most cases being asymptomatic (Amar et al., 2002; Bertrand et al., 2005).  However, the prolonged of giardiasis which causing chronic malnutrition in children has been correlated with poor cognitive functions later in life (Berkman et al., 2001). The earlier molecular studies of Giardia intestinal have been showed eight major genotypes (Berkman et al., 2001). These genotype of Giardia lamblia are infected a wide range of mammalian and others appears to be restricted to groups such as cats, dogs and some infected only one host. The genotypes are including A, B, C, D, E, F, G and H. The A and B genotype are infected many host which include human, cats, dogs, beavers and guinea pigs (Feng Y et al., 2011). Genotype C and D infected dogs and cats, while genotype E infected cattle, sheep and goats, genotype F infected only cats, genotype G infected rats and genotype H infected seals. Only genotypes A and B infected humans and others mammalians, while other genotypes have so far not been detected in human Feng Y et al., 2011).  Genotyping characterization of G. lamblia have been shown a useful tool in epidemiological studies or outbreak investigation (Van der Giessen J et al., 2006; Palmer CS et al., 2008) In view of this, the present study was designed for the detection of Giardia lamblia by Nested PCR and then genotypes on the basis of Nested PCR.

Materials and Methods

Sampling
50 stool samples were collected from patient with severe diarrhea during period between May to September 2016 from Al-Zahraa and Al-Karama hospitals, Wasit, Iraq. The fecal sample was placed to a clean, dry plastic container and transported to the laboratory for analysis.

DNA Extraction
The extraction of genomic DNA from stool samples was done according to company instructions by using stool lysis protocol method with Proteinase K (Stool DNA extraction Kit, Bioneer. Korea) (Haque R et al., 1998; Minvielle M et al., 2008) After that, the extracted gDNA was checked by Nanodrop spectrophotometer, and then stored at -20C at refrigerator until used in PCR amplification. Nested PCR assay was performed for detection and genotyping of Giardia lamblia   from human stool samples.

Nested PCR
The Nested PCR assay was carried out according to (Yason, J et al., 2007) based on two amplifications nested PCR runs by using primers for triosephosphate isomerase (tpi) gene that specific for genotyping A and B. Primers were provided by (Bioneer company. Korea) Table 1.

Table (1):
List of primers that used in Nested PCR amplification

Nested PCR Primer Sequence Amplicon
First round TPIA F CGAGACAAGTGTTGAGATG 576 bp
R GGTCAAGAGCTTACAACACG
TPIB F GTTGCTCCCTCCTTTGTGC 208 bp
R CTCTGCTCATTGGTCTCGC
Second round N-TPIA F CCAAGAAGGCTAAGCGTGC 476bp
R GGTCAAGAGCTTACAACACG
N-TPIB F GCACAGAACGTGTATCTGG 140bp
R CTCTGCTCATTGGTCTCGC

The PCR master mix was prepared by using (AccuPower® PCR PreMix kit. Bioneer. Korea).  The PCR premix tube contains freeze-dried pellet of (Taq DNA polymerase 1U, dNTPs 250µM, Tris-HCl (pH 9.0) 10mM, KCl 30mM, MgCl2 1.5mM, stabilizer, and tracking dye) and the PCR master mix reaction was prepared according to kit instructions (Haque R et al., 1998) in 20µl total volume by added 5µl of purified genomic DNA and 1.5µl of 10pmole of forward primer and 1.5µl of 10pmole of reverse primer, then complete the PCR premix tube by deionizer PCR water into 20µl and briefly mixed by Exispin vortex centrifuge (Bioneer. Korea). The reaction was performed in a thermocycler (Techne TC-3000. USA) by set up the following thermocycler conditions; initial denaturation temperature of 95 °C for 5 min; followed by 30 cycles at denaturation 95 °C for 30 s, annealing 52 °C for 30 s, and extension 72 °C for 1 minute and then final extension at 72 °C for 7 min. The PCR products were examined by electrophoresis in a 1.5% agarose gel, stained with ethidium bromide, and visualized under UV transilluminator Table 2.

Table (2):
The Nested PCR cycles

Repeat cycle Time Temperature PCR step
1 5 min 95 °C Initial Denaturation
30 30 sec 95 °C Denaturation
30 sec 52 °C Annealing
1 min 72 °C Extension
5 min 72 °C Final Extension
RESULTS

The Nested PCR was performed in a total of 50 stool samples for detection of Giardia lamblia, the results showed 36(72%) stool samples were positive, where 14(28%) were negative for Giardia lamblia. Table 3, Figure 1 and 3). The Nested PCR was performed for these samples which were positive for Giardia lamblia for genotyping purpose. The results were 8 (22%) samples Genotype A, 28 (78%) samples Genotype B. Nested Multiplex PCR developed and evaluated in the present study which showed the size of diagnostic fragments of PCR products Table 4, Figure 2 and 4.

Fig. 1. Agarose gel electrophoresis image that show first round PCR product analysis of Giardia lamblia genotype A from human stool samples. Where, Lane (M) DNA marker (100-2000bp), Lane (1-5) some positive at PCR product size 576bp

Fig. 2. Agarose gel electrophoresis image that show second round Nested PCR product analysis of Giardia lamblia genotype A from human stool samples. Where, Lane (M) DNA marker (100-2000bp), Lane (1-5) some positive at PCR product size 476bp Giardia lamblia genotype A

Fig. 3. Agarose gel electrophoresis image that show first round PCR product analysis of Giardia lamblia geno-type B from human stool samples. Where, Lane (M) DNA marker (100-2000bp), Lane (1-5) positive at PCR product size 208bp

Fig. 4. Agarose gel electrophoresis image that show second round PCR product analysis of Giardia lamblia genotype B from human stool samples. Where, Lane (M) DNA marker (100-2000bp), Lane (1-5) positive at PCR product size 140bp as Giardia lamblia genotype B

Table (3):
Show the positive and negative result by using Nested PCR

Samples
Nested PCR detection
Percentage (%)
Positives samples
36
72 %
Negatives samples
14
28 %

Table (4):
Show the Genotyping for the positive PCR samples

Nested PCR genotyping
Total
Positive
Percentage (%)
Genotype A
36
8
22%
Genotype B
36
28
78%
DISCUSSION

Giardia lamblia is one of the widest spread parasites in human’s intestine and animals which causing giardiasis (Roberts and Janovy 2009). This disease is traditionally considered an epidemic and zoonosis disease which infected all ages (Caccio et al., 2005). Genotyping A and B have been finding in human and many other different mammalians (Guy et al., 2004). The present study, describes a Nested PCR strategy for species-specific detection and differentiation of Giardia lamblia DNA directly in the stool samples of patients. In currently study, the detection of genotyping of Giardia lamblia isolated from human by nested PCR amplification were 8 (22%) genotyping A and 28 (78%) genotyping B. our study has shown the presence of Giardia lamblia in Wasit, whereas 36 (72%) stool samples were positive out of 50 stool samples by Nested PCR. Nested PCR was used in the present study because it increases sensitivity. (Foronda et al., 2008). Clinical specimens such as stool often contain PCR inhibitors even after purification steps. The two rounds of Nested PCR might have assisted in compensating the effects of inhibitors present in clinical specimens (Mahdy et al., 2009). The product of first PCR may be just enough to provide adequate templates for the synthesis of second PCR product in the nested reaction to be detected by ethidium bromide staining (Ririe K et al., 1997). The nested multiplex PCR was negative in 14 out of 50 stool specimens. The negative PCR result in these 20 stool samples may be due to the presence of other pathogenic parasite.

This study agrees with (Guy et al., 2004). which observed 17(68%) were genotype B and 3(12%) were genotype A.  There is agreement between our study and other studies in England(Amar et al., 2002) which found that genotype B was (64%) and genotype A was (27%). Also the results of the present study agreed with our results obtained by Marta C et al., (2008). In India, Read et al., (2002) reported that genotype A and B infectious in peoples were (39%) and (61%) respectively. Another study was detected a higher prevalence in genotype B (93.02%) and genotype A (6.98%) (Traub et al., 2004). Also our study confirmed the results of several studies (Amar et al., 2002; Read et al., 2002; Haque et al., 2005; Foronda et al., 2008; Mahdy et al., 2009; Sarkari et al., 2012) which showed that infections with genotype B was more prevalent than infections with genotype A. However, the present study disagreed with the finding of other researchers (Sambrook et al., 2000; Pestehchian et al., 2012) who observed that the infection associated with genotype A was higher than the infection associated with genotype B.

CONCLUSION

Nested PCR is considered as an alternative tool in epidemiological studies and the diagnosis of Giardiasis and for genotyping of Giardia lamblia. The results showed that Genotype B was the more frequent which common in Wasit, Iraq, while the lowest frequent was Genotype A.

References
  1. Adam, R. D. Biology of Giardia lamblia. Microbiology Review. 2001. 14: 447-475.
  2. Berkman, D. S., A. G. Lescano, R. H. Gilman, S. L. Lopez, and M. M. Black. Effects of stunting, diarrhoeal disease, and parasitic infection during infancy on cognition in late childhood: a follow-up study. Lancet. 2002; 359: 564-571.
  3. Fricker, C. R., G. D. Medema, and H. V. Smith. Guidelines for drinking-water quality. World Health Organization, Geneva, Switzerland. 2nd ed., 2002; p. 70-118.
  4. Karanis, P. A. Review of an emerging waterborne medical important parasitic protozoan. Japanese Journal of Protozoology. 2006; 39: 5-19.
  5. Ortega Y.R, Adam R.D. Giardia: overview and update. Clinical Infectious Disease; 1997; 25: 545-549.
  6. Ankarklev J, Jerlström-Hultqvist J, Ringqvist E, Troell K, Svärd SG. Behind the smile: cell biology and disease mechanisms of Giardia species. Natural Review of Microbiology, 2010; 8: 413-422.
  7. Mohammed Mahdy A, Surin J, Wan K, Mohd-Adnan A, Al-Mekhlafi M, Lim Y. Giardia intestinalis genotypes: Risk factors and correlation with clinical symptoms. Acta Tropica., 2009; 112: 67-70.
  8. Balcioglu, I. C.; E. Limoncu, P.; Ertan, K.; Yereli, A.; Özbilginve and A. Ona. Incidence of giardiasis among siblings in Turkey. Pediatrics International., 2003; 45: 311–313.
  9. Duffy, T. L.; Montenegro-Bethancourt, G.; Solomons, N. W.; Belosevic, M. and Clandinin, M. T. Prevalence of giardiasis in children attending semi-urban daycare centres in Guatemala and comparison of 3 Giardia detection tests. Journal of Health, Population and Nutrition. 2013; 31: 290–293.
  10. Pakianathan, M. R. and McMillan, A. Intestinal protozoa in homosexual men in Edinburgh. International Journal of STD & AIDS, 1999; 10: 780–784.
  11. Escobedo, A. A.; Almirall, P.; Alfonso, M.; Cimerman, S. and Chacin-Bonilla, L. Sexual transmission of giardiasis: a neglected route of spread? Acta Tropica., 2014; 132: 106–111.
  12. Amar, C. F. L., P. H. Dear, S. Pderaza-Diaz, N. Looker, E. Linnane, and J. Mclauchlin. Sensitive PCR-restriction fragment length polymorphism assay for detection and genotyping of Giardia duodenalis in human feces. Journal of Clinical Microbiology. 2002; 40:446-452.
  13. Bertrand, I., L. Albertini, and J. Schwartzbrod. Comparison of two target genes for detection and genotyping of Giardia lamblia in human feces by PCR and PCR-restriction fragment length polymorphism. Journal of Microbiology, 2005; 43: 5940-5944.
  14. Thompson, RC. and Monis, PT. Variation in Giardia: implications for taxonomy and epidemiology. Advances in Parasitology. 2004; 58: 69–137.
  15. Feng Y, Xiao L. Zoonotic potential and molecular epidemiology of Giardia species and giardiasis. Clinical Microbiology Review. 2011; 24: 110-140.
  16. Palmer CS, Traub RJ, Robertson ID, Devlin G, ReesR, Thompson R. Determining the zoonotic significance of Giardia and Cryptosporidium in Australian dogs and cats. Veterinary Parasitology. 2008; 154: 142-147.
  17. Van der Giessen J, De Vries A, Roos M, Wielinga P,Kortbeek L, Mank T. Genotyping of Giardia in Dutch patients and animals: A phylogenetic analysis of human and animal isolates. International Journal of Parasitology. 2006; 36: 849-58.
  18. Haque R, Ali IKM, Akther S, Petri W.A Comparison of PCR, isoenzyme analysis and antigen detection for diagnosis of Entamoeba histolytica infection. Journal of Clinical Microbiology. 1998; 36: 449-452
  19. Minvielle M.C., Molina N.B., Polverino D., Basualdo J.A. First genotyping of Giardia lamblia from human and animal feces in Argentina, South America Mem. Inst. Oswaldo Cruz, 2008; 103: pp. 98-103
  20. Yason, J. A. and W. L. Rivera. Genotyping of Giardia duodenalisisolates among residents of slum area in Manila, Philippines. Parasitology Reserch., 2007; 101:681–687.
  21. Roberts, L. and Janovy, J. Foundation of Parasitology. 8th edition. McGraw Hill., USA.: 2009; 701.
  22. Caccio, S. M., R. C. Thompson, J. McLauchlin, and H. V. Smith. Unravelling Cryptosporidium and Giardia epidemiology. Trends in Parasitology 2005; 21:430–437.
  23. Guy, R., Xiao, C. and Horgen P. Real time PCR assay for detection and genotype differentiation of Giardia lambliain stool specimens. Journal of clinical microbiology. 2004; 42: 3317-3320.
  24. Marta, C Minvielle, Nora B Molina, Daniela Polverino and Juan, A. Basualdo. First genotyping of Giardia lamblia from human and animal feces in Argentina, South America. Memórias do Instituto Oswaldo Cruz Instituto Oswaldo Cruz, Rio de Janeiro. 2008; 103(1): 98-103.
  25. Traub, R.J, Monis, P.T, Robertson, I, Irwin, P, Mencke, N and Thompson, R.C.A. Epidemiological and molecular evidence supports the zoonotic transmission of Giardia among humans and dogs living in the same community. Parasitology, 2004; 128: 253–262.
  26. Read C, Walters J, Robertson ID, Thompson RC. Correlation between genotype of Giardia duodenalis and diarrhoea. International Journal of Parasitology. 2002; 32: 229-231.
  27. Foronda P, Bargues MD, Abreu-Acosta N, Periago MV, Valero MA. Identification of genotypes of Giardia intestinalis of human isolates in Egypt. Parasitology Research. 2008; 103: 1177-1181.
  28. Mahdy AM, Surin J, Wan KL, Mohd-Adnan A, Al-Mekhlafi MH, Lim Y. Giardia intestinalis genotypes: Risk factors and correlation with clinical symptoms. Acta Tropical. 2009; 112: 67-70.
  29. Haque R, Roy S, Kabir M, Stroup SE, Mondal D. Giardia assemblage A infection and diarrhea in Bangladesh. Journal of Infectious Disease. 2005; 192: 2171-2173.
  30. Sarkari B, Ashrafmansori A, Hatam GR, Motazedian MH, Asgari Q. Genotyping of Giardia lamblia isolates from human in southern Iran. Tropical Biomedicine; 2012; 29: 366-371.
  31. Pestehchian N, Rasekh H, Babaei Z, Yousefi HA, Eskandarian AA, Kazemi M, Akbari M. Identification of genotypes of giardia duodenalis human isolates in isfahan, iran, using polymerase chain reaction-restriction fragment length polymorphism. Advanced Biomedical Research. 2012; 1: 84.
  32. Sambrook J, Russell DW: Gel. Electrophoresis of DNA and Pulsed-field Agarose Gel Electrophoresis. In Molecular Cloning, A Laboratory Manual 3rd edition. New York, USA, Cold Spring Harbor Laboratory Press., 2000; 5.14-5.15.
  33. Ririe K.M, Rasmussen R.P and Wittwer CT. Product differentiation by analysis of DNA melting curves during the polymerase chain reaction. Analytical Biochemistry., 1997; 245: 154-160.

Article Metrics

Article View: 8044

Share This Article

© The Author(s) 2018. Open Access. This article is distributed under the terms of the Creative Commons Attribution 4.0 International License which permits unrestricted use, sharing, distribution, and reproduction in any medium, provided you give appropriate credit to the original author(s) and the source, provide a link to the Creative Commons license, and indicate if changes were made.