Garima Verma1, Nadim Chishty1 and Chandra Veer2

1Department of Zoology, Government Meera Girls College, Mohan Lal Sukhadia University, Udaipur – 313 001, Rajasthan, India.
2Department of Dairy & Food Microbiology, College of Dairy & Food Science Technology, MPUAT, Udaipur, Rajasthan, India.

ABSTRACT

The present study deals with isolation and characterization of lead resistant bacteria isolated from two water bodies Udaisagar lake and Gadwa pond of Berach river system, Udaipur, Rajasthan, India. Initially, among 13 of the total isolates screened from water samples, 2 isolates were selected for study based on high level of heavy metal resistances. On the basis of morphological, biochemical and molecular characterization using 16SrDNA sequencing the isolates were identified as Pseudomonas stutzeri (KX692284)and Pseudomonas stutzeri (KX692285). The isolates exhibited high resistance to lead (Pd). The Minimum Inhibitory concentration (MIC) of the isolates against lead was determined using agar plate dilution method. Pseudomonas stutzeri showedhighest MIC value of lead up to 1600 mg/l concentration. The uptake of heavy metals, present in water and detoxification of metal ions by bacteria provide an additional mechanism of environmental bioremediation. The identified lead resistant bacteria could be useful for the bioremediation of heavy metal contaminated sewage and waste water from various industries.

Keywords:Pseudomonas stutzeri, lead resistant bacteria, Minimum Inhibitory concentration (MIC), bioremediation, 16SrDNA sequencing.

INTRODUCTION

Heavy metal pollution of soil and wastewater is a significant environmental problem (1). Wastewaters from the industries and sewage sludge applications have permanent toxic effects to human and the environment (2). It is well established that domestic sewage and industrial effluents that fall into natural water bodies change the water quality and lead to eutrophication. Water quality means the physical, chemical and biological characteristics of water. Various pollutants influence the water quality of water bodies and there by influencing the biota therein. Unlike many other pollutants, heavy metals are difficult to remove from the environment (3). Someheavy metals are useful to us in low concentrations but are highly toxic in higher concentrations (4). Lead is hazardous to children even in very low concentration and causes mental retardation.Chemical methods such as precipitation, evaporation, electroplating, ion-exchange etc. have been widely used to remove metal ions from industrial waste water but these methods are ineffective or expensive and have several disadvantages such as unpredictable metal ion removal, high reagent requirement, generation of toxic sludge etc. There are number of biologicalmaterials that can be use to remove metals from waste water, such as molds, yeasts, bacteria, and seaweeds (5&6). The ability of micro-organisms is recognized for environmental management, and microbes have superseded the conventional techniques of remediation. This ability of microbial stains to grow in the presence of heavy metals would be helpful in the waste water treatment where microorganisms are directly involved in the decomposition of organic matter in biological processes for waste water treatment (7&8)In this study two water bodies lake Udaisagar and Gadwa pond belonging to Berach river system,Udaipur region were selected to isolate and characterize lead resistant bacteria. The morphological, biochemical and molecular characterization using 16SrDNA sequencing of isolates have been done to identify the metal resistant isolates. These isolates can be used to remove toxic heavy metals from industrial effluents.

 

 MATERIAL AND METHODS

Sample collection

Samples of water were collected from heavy metal contaminated sites of Udaisagar lake and Gadwa pond,Udaipur, Rajasthan, India and kept in sterile plastic bottlesunder refrigeration to ensure minimal biological activityuntil processing in laboratory.

Isolation of lead resistant bacteria

Lead resistant bacteria were isolated on nutrient agarsupplemented with 100 mg/l concentration of lead acetateheptahydrate by the standard pour plate method. Plates wereincubated at 37oC for 24-48 hours.

Morphological and Biochemical characterization of lead resistant bacteria

 

Characterization of isolates was done by studyingmorphological (Gram staining and shape)and biochemical characteristics (catalase activity, oxidaseactivity, acid production from glucose, citrate utilization and nitrate reduction). Thetests were used to identify the isolates according to Bergey’smanual of systematics bacteriology (9).

Determination of Minimum Inhibitory Concentration(MIC) of lead for isolates

 

The MIC was defined as the lowest concentration of the heavy metal that inhibits the visible growth of the organisms. After the preliminary isolation of the lead tolerant bacteria,the Minimum Inhibitory Concentration (MIC) of lead wasdetermined by agar plate dilution method(10).The metal lead was used in different concentration ranging from 1000mg/l to 2000 mg/l. Stock solutions of the metalsalt (lead acetate) were prepared in sterile water to obtainfinal concentrations of 1000 to 2000 mg/llead. The petri plates were inoculated with 10 µl of an overnight broth cultureand incubated at 37ºC for 24-72 hours.

Isolation of genomic DNA:

Genomic DNA from all the isolates was extracted with some modification in phenol chloroform method. Bacteria were cultured overnight in nutrient broth and 1.5 ml of culture was harvested in TE buffer (pH8). Lysis was initiated by the addition of lysozyme (4mg/ml). After incubation at 37°C for 30 minutes, 40 μl of 10% sodium dodecyl sulphate (SDS) was added and the tubes were incubated at 45°C for 60 minutes. Cell debris and protein were separated with phenol and chloroform extraction and DNA was precipitated by adding sodium acetate (3M) and absolute ethanol.Tubes were incubated at -20°C for 12 hours. After incubation, tubes were centrifuged and the pellet was washed with 70% ethanol and air dried. The pellet was dissolved in 100 μl of TE buffer and stored at -20°C for further use.

 

16SrDNA amplification:

The 16SrRNA gene of bacteria was amplified using 16SrRNA gene sequence as forward primer

(5’AGAGTTTGATCCTGGCTCAG-3’) and as reverse primer (5’ AAGGAGGTGATCCAGCCGCA 3’). The PCR conditions were standardized as follows. Initial denaturation at 94°C for 5 minutes, 35 cycles of denaturation at 94°C for1minute, annealing at 55°C for 45 sec and extension at 72°C for 1 minutes and the final extension at 72°C for 10 minutes. The resulting amplified products were run on 1.5% agarose gel andvisualized by using gel documentation system (Gel Doc XR+, Bio Rad).

16S rDNASequence analysis:

Amplified 16SrDNA products were sequenced from Bioinovations, Mumbai. Sequencing was determined by the dideoxy chain termination method. The closest relatives of 16SrDNA sequences were determined by a search of the GenBank DNA database using the BLAST algorithm. Homology comparisons were performed using the Basic Local Alignment Search Tool (BLAST), online at the National Centre for Biotechnology Information (NCBI) homepage (www.ncbi.nlm.nih.gov). Identities of isolates were determined based on the highest score.

RESULTS

Isolation of lead resistant bacteria

A total 13indigenous bacterial strains were recovered from water samples onnutrient agar supplemented with 100mg/l concentration of lead acetateheptahydrate by the standard pour plate method.Further all of these isolates were grown on 500 mg/ml concentration of lead. Out of them, two strainsGVP1a and GVP2 were selected that showed growth at this concentration.

Table 1: Morphological and biochemical characterization of lead resistant isolates.

Characteristics Lead resistant Isolates
GVP1a GVP2
Morphology(Colony colour and Shape) Pale color, irregular Pale color, irregular
Cell Shape Rod Rod
Gram Reaction
Catalase + +
Oxidase + +
Citrate Utilization + +
Nitrate Reduction + +
Glucose Fermentation

 

       + = Positive, – = Negative

Morphological and biochemical characterization

Two selected isolates werecharacterized by detecting their cultural, morphological andbiochemical characteristics (Table 1). The investigationresults indicated that both the isolates were gram-negative,rod-shaped bacteria and gave positive reaction forcatalase activity, oxidase activity, reducesnitrate and utilizes citrate. Both the isolates gave negative reaction forfermentation of glucose.The above results obtained for morphological andbiochemical characteristics were further matched withBergey’s manual of systematics bacteriology (9).

Table 2: Minimum Inhibitory Concentration (MIC) value of lead for two lead resistant isolates

Isolate
MIC (mg/l)
GVP1a
1400
GVP2
1600

 

Minimum Inhibitory Concentration of lead ions

The MIC of lead was determined using increasing concentrations of lead (1000 to 2000 mg/l). The growth of the isolate GVP1a and isolate GVP2 were observed after 72 hours of incubation in the nutrient agar medium up to 1400 and 1600 mg/l concentration of lead. The results showed in Table 2 revealed that MIC of lead for isolatesGVP1a and GVP2 was 1400 and 1600 mg/l respectively. Isolate GVP2 showed maximum value of MIC.GVP1a and GVP2 didn’t show any growth on higher concentration of lead (1500 mg/l and 1700 mg/l respectively).

 

Molecular identification of lead resistant bacteria

Genomic DNA was isolated and visualized on 1.0 percent agarose gel. For the identification of isolates at species level the 16SrDNA amplification was done using PCR technique. Amplified products were run in 1.5 percent agarose gel and visualized using gel documentation system. The amplified products of isolates were sequenced and the obtained sequences were compared with the available gene sequences at NCBI website by using BLASTn. Sequences submitted to GenBank, USA (Table 3) showing more than 95% similarity with the GenBank sequences.

Table 3: Accession numbers generated by GenBank, NCBI, USA for submitted nucleotide     sequences of lead resistant isolates.

S.No.
Isolate
Accession number
Name of identified strain
1
GVP1a
KX692284
Pseudomonas stutzeri
2
GVP2
KX692285
Pseudomonas stutzeri

 

Discussion:

Heavy metal resistant bacteria have been isolated from soil, industrial effluents, fresh water bodies, rivers, waste water and sewage(11,12,13,14). In this study lead resistant bacteria were isolated from polluted sites of water bodies named as Udaisagar lake and Gadwa pond of Berach river system,Udaipur.

A total of 13 bacterial isolates were recovered on nutrient agar supplemented with 100 mg/l concentration of lead acetate. Out of them 2 isolates were selected on the basis of high level of lead resistance (up to 500 mg/l). Morphological characterization of isolates showed these isolates asGram-negative species. It shows that Gram-negative bacteria have the ability of heavy metal resistance which was also reported in studies of heavy metal resistances. (15&16).Pseudomonas stutzeri isolates GVP1a and GVP2 showed high level ofMinimum inhibitory concentration values 1400 and 1600 mg/l repectively. Maximum MIC of lead for the isolates was found upto 1600 mg/l.MIC value of lead for Bacillus cereus was reported at 1000mg/l concentrationand MIC of zinchave been reported at 10mM for Pseudomonas aeruginosa(14&16).Molecular Identification of metal resistant bacteria have been done using 16SrDNA sequencing technique, this technique was also used in various studies for the identification of metal resistant isolates at species level.(17 & 12). In this study Pseudomonas stutzeri was identified as lead resistant bacteria. Similarly Pseudomonas sp.have been identified as heavy metal resistant bacteria (15) andPseudomonas aeruginosa HMR1 and Pseudomonas aeruginosa HMR16 have been identified as zinc tolerant bacteria (16).

Conclusion

The industrial effluents and waste water are rich source of heavy metals and bacteria reside in these waters must be resistant to heavy metals. The isolation of lead resistant bacteria from polluted sites of Udaisagar lake and Gadwa Pond and their molecular characterization using 16SrDNA sequencing up to species level lead to the application of these isolates for the removal of lead from waste water. The results of the study suggest that Pseudomonas stutzeri species can be useful for the bioremediation of lead contaminated industrial effluents and waste waters.

Acknowledgment

The authors gratefully acknowledge the financial support received from Rajiv Gandhi National Fellowship, University Grant Commission, New Delhi.

REFERENCES

  1. Cheng, S. Heavy metal pollution in China: origin, pattern and control. Sci. Pol. Res., 2003;10:192-98.
  2. Rehman, A. Z., Muneer, B., &Hasnain, S. Chromium tolerance and reduction potential of a Bacillus ev3 isolated from metal contaminated wastewater. Bull. Env.Cont. Toxi., 2008; 81: 25-29.
  3. Ren, W. X., Li, P. J., Geng, Y., & Li, X. J. Biological leaching of heavy metals from a contaminated soil by Aspergillusniger. J. Mate.,2009; 167(1-3): 164-69.
  4. Ge, H.W., Lian, M.F., Wen, F.Z., Yun, Y.F., Jian, F.Y.and Ming, T. Isolation and characterization of the heavy metal resistant bacteria CCNWRS33-2 isolated from root nodule of Lespedeza cuneata in gold mine tailings in China. Haz. Mate., 2009; 162:50-56. doi:10.1016/j.jhazmat.2008.05.040
  5. Vieira, R. and Volesky, B. Biosorption: a solution to pollution? J. Foo. Micro., 2000; 3: 17-24.
  6. Waisberg, M., Joseph, P., Hale, B. and Beyersmann, D. Molecular mechanism of cadmium carcinogenesis. Toxi., 2003; 192: 95-117.doi:10.1016/S0300-483X(03)00305-6
  7. Munoz, R.A., Munoz, M.T., Terrazas, E., Guieysse, B. and Mattisasson, B. Sequential removal of heavy metals ions and organic pollutants using an algal-bacterial consortium. , 2006; 63: 903-991. doi:10.1016/j.chemosphere.2005.09.062
  8. Prasenjit, B. Sumathi, and S. Uptake of chromium by Aspergillusfoetidus. Mat. Cyc. Was. Man., 2005; 7: 88-92.doi:10.1007/s10163-005-0131-8
  9. Claus D. and Berkeley, R.C.W. “Genus Pseudomonas. In Bergey’s Manual of Systematic Bacteriology,” P.H.A. Sneath, N.S. Mair and M.E. Sharpe, Eds. Baltimore: Williams and wilkins, 1; 1986;pp140-219.
  10. Malik, A. and Jaiswal, R. Metal resistance in Pseudomonas strains isolated from soil treated with industrial wastewater. J . Micro. Biotech., 2000; 16: 177–82.
  11. Mgbemena, C., Nnokwe, J. C., Adjeroh, L. A., &Onyemekara, N. N. Resistance of bacteria isolated from Otamiririver to heavy metals and some selected antibiotics. Res. J. Bio. Sci., 2012; 4(5): 551-56.
  12. Pandit, R. J., Patel, B., Kunjadia, P. D., and Nagee, A. Isolation, characterization and molecular identification of heavy metal resistant bacteria from industrial effluents, Amala-khadi- Ankleshwar, Gujarat. J. Env. Sci., 2013;3(5):1689-99.
  13. Narasimhulu, K., Rao, P. S. and Vinod, A. V. Isolation and identification of bacteria strains and study of their resistance to heavy metals and antibiotics. J. Micro. Bioch. Tech., 2010; 2(3): 74-76.
  14. Murthy, S., Bali, G. and Sarangi S. K. Lead biosorption by a bacterium isolated from industrial effluents. J. Micro. Res., 2012; 4(3): 196-200.
  15. Bhojia, A.A. and Joshi, H. Characterization and zinc tolerance of pseudomonas isolated from Zawar mines Udaipur, India. Herb. Medi. andToxi., 2014; 8(1): 62-66.
  16. Bhojia, A.A. and Joshi, H. Isolation and characterization of zinc tolerant bacteria from Zawar mines Udaipur, India. J. Env. Eng. Manag., 2012; 3(4): 239-42.
  17. Chatterjee, S., Mukherjee, A., Sarkar, A. and Roy, P. Bioremediation of lead by lead resistant microorganisms, isolated from industrial sample. Biosci. Biotech., 2012; 3: 290-95.