Charlie C. Luchen1, Percy M. Chimwamurombe2* and Larry Hale3

1Department of Biological Sciences, Faculty of Science, University of Namibia,
Private Bag 13301, 340 Mandume NdeMufayo Avenue, Windhoek, Namibia.
2Department of Biological Sciences, Faculty of Science, University of Namibia,
Private Bag 13301, 340 Mandume NdeMufayo Avenue, Windhoek, Namibia.
3University of Prince Edward Island, 550 University Avenue, Charlottetown, PE C1A 4P3, Canada.

Abstract

Detection of phytopathogens that are involved in causing disease symptoms in plants and crops is of prime importance as a key step in disease treatment and management. Ziziphu smucronata is a species endemic in temperate and tropical climates and used traditionally in the treatment of infectious diseases. The common bean (Phaseolus vulgaris) is a rich source of nutrients for the human diet. Just like most crops, it is not immune to fungal diseases and reports had been received of P. vulgaris showing signs on disease. The aim of this study was to isolate and characterize the fungal species associated with the disease symptoms in the Z. mucronata and P. vulgaris. Fungal species where isolated from surface-sterilised symptomatic bark of Z. muconata and fresh green bean pods. These where grown on petri dishes containing Potato Dextrose Agar and incubated at room temperature. Pure cultures where then obtained by transferring small segments of fungal growth to a new petri dish that contained PDA. During DNA extraction the pure cultures where first homogenized using liquid nitrogen and then the rest of the extraction carried out as stipulated in the Zymo extraction kit. The Nanodrop was used for quantifying the DNA and amplification of the conserved Internal Transcribed Spacer (ITS) region of Ribosomal RNA genes was carried out using ITS1 and ITS2. The PCR products were sequenced at Inqaba Biotech Industries in South Africa. The obtained sequences were then compared by alignment with known sequences in the Genbank using Basic Local Alignment Search Tool (BLAST). The BLAST searches were able to reveal the fungi isolated from the Z. mucronata as Fusariumpenzigii and Fusariumdimerum while the fungi isolated from P. vulgarisshown to be Phomadestructiva, with 100 %, 95% and 100% sequence similarity respectively. The next step in this work is carry out Koch‘s postulates to determine which of this fungi is the causal agent of the observed diseases symptoms in order to start a targeted diseases management programme.

Keywords: Ziziphusmucronata, Phaseolus vulgaris, Internal Transcribed Sequence, alignment, BLAST, Fusariumdimerum, Fusariumpenzigii, Phomadestructiva.

Introduction

 The Ziziphusmucronataalso known as the Buffalo thorn is a small tree with a spreading canopy that has characteristic zigzag young twigs with two significant thorns at the node, with one facing forward and the other backwards. Z. mucronata is a multipurpose tree with a variety of traditional importance such as being believed to protect from lighting in Botswana (Mazibuko, 2007). (Mazibuko, 2007) stated that many parts of the plant are used in ethno medicine with the tannins playing a role in dysentery treatment and the roots being used in East Africa to treat snake bites, also went on to say that these properties have been attributed to the peptide alkaloids and antifungal properties isolated from the bark and leaves.

The common bean (Phaseolus vulgaris) also called the green bean is a herbaceous legume that has its origin in South and Central America, it is now cultivated worldwide for its high nutritious value (Earth, 2011). The activity of bacteria found in its root nodules is able to confer nitrogen fixing properties to the bean. Due to poor management, the beans may be exposed to high moisture and temperature during storage and harvest, this may provide a suitable environment for fungal growth which might lead to contamination by mycotoxins (Scussel, 2000).

This research aimed to address the problem of lack of information on identity of plant diseases in Z. mucronataand common green beans. Fungi cause a wide range of crop and plant diseases worldwide. The Ziziphusmucronata is one of the important ethno medical plants in Africa and Asia. It has medical properties such as antitumor, anticancer and anti-diabetic. There have been various reports on green beans showing signs of diseases and a few studies have been conducted to follow up these reports hence the reason behind this study focusing on fungi causing diseases on the common green beans.

 

MATERIALS AND METHODS

Sampling Area

Symptomatic plant tissue from Z mucronata was collected from the University of Namibia while the diseased green beans samples where obtained in local green grocer shops. To minimize destruction of the plant, nondestructive sampling was carried out.

Obtaining and Sterilization of Samples

Branches that showed disease symptoms where obtained from the tree and fresh green beans pods where also obtained.The symptomatic tissues where then surface sterilized according to the procedure used in (Garas, et al., 2012).

Isolation of Fungi

After the sterilization, a piece of crop tissue from the bean pod and from the Ziziphusmucronata stem with fungal growth on it was cut and transferred onto an agar plate containing Potato Dextrose Agar. The fungi was then incubated at room temperature of 25oC and left to grow for5 days. Sub culturing was performed where required and after pure cultures of the fungi where obtained from single spores, these cultures had to be stored in 30% glycerol.

 

DNA Extraction andPCR Amplification

 DNA was then extracted from the pure cultures using the ZYMO Fungal DNA extraction kit according to the manufacturer’s manual. Gel electrophoresis was carried out so as to confirm the presence or absence of fungal DNA which was evident from the bands. Further quantification was then carried out using a Nano drop. PCR was carried out with the following PCR mixtures: Buffer (12.5µl), DNA (4µl), sterile water (5.5µl) and primers (3µl) giving a total master mix mixture of 25µl. The Amplification was done using ITS1 and ITS2 primers at a primer concentration of 0.8uM with the following profile: Pre-denaturation of DNA, 94°C for 4 minutes,Denaturation of target DNA; 94ºC for 20 seconds,

Primer annealing; 59ºC for 30 seconds,Primer elongation; 72ºC for 1 minute, Final elongation; 72ºC for 10 minute and Final hold at 4ºC The amplicons where then sent to InqabaBiotech Industries for automated sequencing of the ITS region.

DNA Sequence Analysis

ITS 1 and ITS 2 primersthat had been used for amplificationwere used for sequencing in both

forward and reverse directions with the obtained sequences being used to perform Blast searches

in the NCBI Genbank. The integrity of the sequenceswas ensured by eye inspection.

 

RESULTS AND DISCUSSION

Fungal cultures where obtained from tissue of the Z. mucronata showing symptoms of infection and sub culturing was carried out until pure cultures were obtained as depicted in figures 2 and 3. Fusariumdimerum could be identified from the plates due to the morphological orange color it grew with.

DNA was then extracted from the pure cultures and Gel electrophoresis was run and aThermo Scientific NANADROP 2000c a product of MET supplied by Bio Dynamics used to quantify the DNA.

The obtained amplicons were then cleansed and sequenced. After BLASTN the fungi responsible for the disease symptoms in the Z. mucronata where revealed by 100% and 94% similarity as Fusariumpenzigii and Fusariumdimerum respectively.While Phomadestructiva was revealed to be the isolate from P. vulgaris.

 

 

 

 

 

 

 

 

 

 

 

Query  14   CGCTGCGTTCTTCATCGATGCCAGAACCAAGAGATCCGTTGTTGAAAGTTTTAATTGATT  73

||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||

Sbjct  199  CGCTGCGTTCTTCATCGATGCCAGAACCAAGAGATCCGTTGTTGAAAGTTTTAATTGATT  140

 

Query  74   GTGTTTTTACTCAGAAGATACTAAGAATAACAGGGTTTGTTGGGTCCTCTGGCGGGCCGT  133

||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||

Sbjct  139  GTGTTTTTACTCAGAAGATACTAAGAATAACAGGGTTTGTTGGGTCCTCTGGCGGGCCGT  80

 

Query  134  CCCGTTTTACGGGGAAGCGGGGGTCCGCCGAGGCAACGTTATAGGTATGTCACAGGG  190

|||||||||||||||||||||||||||||||||||||||||||||||||||||||||

Sbjct  79   CCCGTTTTACGGGGAAGCGGGGGTCCGCCGAGGCAACGTTATAGGTATGTCACAGGG  23

Fig. 4.Partial display of local pairwise sequence alignment of ITS regions showing 100% similarity to Fusariumpenzigii(Query) sequence that was against the subject sequence in the GenBank database.

Query  8    AGTTTT-ATTGATTGTGTTTTTACTCAGAAGATACTAAGAATAACAGGGTTTGTTGGGTC  66

|||||| |||||||||||||| |||||||||||||| | |||||||| ||||||||||||

Sbjct  184  AGTTTTAATTGATTGTGTTTTCACTCAGAAGATACTGAAAATAACAGAGTTTGTTGGGTC  125

 

Query  67   CTCTGGCGGGCCG-TCCCGTTTTACGGGGAAGCGGGGGTCCGCCGAGGCAACGTTATAGG  125

||||||||||||| |||||| ||||||||| |||||||||||||||||||||||||||||

Sbjct  124  CTCTGGCGGGCCGCTCCCGTCTTACGGGGAGGCGGGGGTCCGCCGAGGCAACGTTATAGG  65

 

Query  126  TATGTTCACAGGGGTTTGGGAGTTGTAAACTCGGTAATGATCCCTCCGCAGGWTCACCTA  185

|||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||

Sbjct  64   TATGTTCACAGGGGTTTGGGAGTTGTAAACTCGGTAATGATCCCTCCGCAGGTTCACCTA  5

 

Query  186  CG  187

||

Sbjct  4    CG  3

Figure.5. Partial display of local pairwise sequence alignment of ITS regions showing 95% similarity to Fusariumdimerum(Query) sequence that was against the subject sequence in the GenBank database and 5% mismatch.

Query  10   AGTTGTAACTATTAAGTTTTTTCAGACGCTGATTGCAACTGCAAATGGTTTAAATTGTCC  69

||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||

Sbjct  178  AGTTGTAACTATTAAGTTTTTTCAGACGCTGATTGCAACTGCAAATGGTTTAAATTGTCC  119

 

Query  70   AATCGGCGGGCGGACCCGCCGAGGAAACGAAGGTACTCAAAAGACATGGGTAAGAGATAG  129

||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||

Sbjct  118  AATCGGCGGGCGGACCCGCCGAGGAAACGAAGGTACTCAAAAGACATGGGTAAGAGATAG  59

 

Query  130  CAGGCAAAGCCTACAACTCTAGGTAATGATCCTTCCGCAGGTTCACCTACGGAAG  184

|||||||||||||||||||||||||||||||||||||||||||||||||||||||

Sbjct  58   CAGGCAAAGCCTACAACTCTAGGTAATGATCCTTCCGCAGGTTCACCTACGGAAG  4

 

Figure.6. Partial display of local pairwise sequence alignment of ITS regions showing 100% similarity to Phomadestructiva(Query) sequence that was against the subject sequence in the GenBank database.

(Maier, et al., 2014)whocarried out one of the few available studies on diseases of the Z. mucronataconcluded that Coniodictyumchevalieriwas responsible for the diseases symptoms that where observed in the Z.mucronata found in the Kruger National Park in South Africa. The authors also went on to state that C. chevalierihas a unique biology, regarding its biogeography, ecology and host specificity, as it only infects Z mucronata.

Most studies that have been carried out on the Z. mucronatahave been focused on mostly its ethno medical importance and a few studies have been documented on the diseases that affect the plant. Fusaruim species have proved to the causal agents of most plant and crop diseases not neglecting their effects on certain opportunistic infections in humans as indicated in (Salah, et al., 2015) where they are indicated to be found in wounds, blood, nails, cornea, urine and skin.

Fusariumdimerum had been believed to be decaying plant saprothrophs, take (Gerlach & Nirenberg, 1982) who were unaware of F. dimerumcausing any plant diseases when they carried out their studies. The findings of this study thus refutes that belief as it has shown that the fungi is also associated with disease symptoms in plants. It is also now known as a species complex normally abbreviated (FDSC) which contains at least 12 lineages, of which F. dimerumsensustricto, F. delphinoides, and F. penzigii are common distinct species according to (van Diepeningen, et al., 2014), (Josef, et al., 2008) also goes on to support this claim by stating that Fusariumdimerumis known to comprise of at list 12 phylogenetically distinct species and is only known for its anamorph.

Fusariumpenzigii was named in honor of an Italian mycologist by the name of AlbertusGiulioOttonePenzig. Just like the F. dimerum species complex it is widely known to be a soil and dead plant substrata pathogen or as an agent of trauma-related eye infections of humans so this report is one of the rare ones that indicates its role in causing plant diseases.

The results showed that Phomadestructiva was responsible for the disease symptoms on the green beans. This observation is one that has not been widely documented in literature as P.destructiva has mostly been reported to cause disease symptoms in tomatoes. Phomopsis blight of tomatoes is known to be caused by the fungi Phomadestructiva, it causes rot spots that are usually sunken ,light colored at margins and leathery, the fungus also produced pcynidia in dark portions of the tomato (Wani , 2011).

This study was limited in that there was not enough time available to collect the seedlings of the Ziziphusmucronata and carry out Koch’s postulates so as to test the obtained species for pathogenesis. The results of this study support the hypothesis that fungi was responsible for the symptoms observed on the Ziziphusmucronata and the Phaseolus vulgaris. With the fungi suspected to be responsible being isolated and characterized to the species level which was the main objective of this study. It can thus be concluded that Z.mucronata is susceptible to infection by Fusarumpenzigiiand Fusariumdimerum while the common green beans is susceptible to Phomadestructivainfection. To be able to confidently point out the isolated fungi as the casual agents, a couple of more experiments should be designed and further extensive studies should be carried on the isolates.

 

 CONCLUSION

The results of this study supported the hypothesis that fungi was responsible for the symptoms observed on the Ziziphusmucronata and the Phaseolus vulgaris. With the fungi suspected to be responsible being isolated and characterized to the species level which was the main objective of this study. It could thus be concluded that Z.mucronata was susceptible to infection by Fusarumpenzigiiand Fusariumdimerum while the common green beans was susceptible to Phomadestructivainfection.

 

REFERENCES

  1. Avise, J. C., 2007. Twenty-five key evolutionary insights from the phylogeographic revolution in population genetics. SpringerLink, 7-21.
  2. Benny, G. L., Humber, R. L. & Morton, J., n.d. Zygomycota;Zygomycetes. SpringerLink, 113-146.
  3. Brandt, M. E., Lockhart, R. S. & Warnock, D., 2010. Laboratory Aspects of Medical Mycology. Atlanta: SpringerLink.
  4. Capote, N., Pastrana, M. A., Aguado, A. & Torres, S. P., 2012. Molecular Tools for identification of plant pathogenic fungi and fungicide resistance.
  5. Chi, M.-H., Park, S.-K. & Lee, Y.-H., 2009. A Quick and Safe Method for Fungal DNA Extraction. Plant Pathology, 25(1), pp. 108-111.
  6. Christou, P. & Twyman, R., 2004. The Potential of genetically enhanced plants to address food insecurity. NCBI, 23-40.
  7. Crous, P. et al., 2006. How Many Species Of fungi Are There At the Tip Of Africa. NCBI, 13-20.
  8. Earth, A., 2011. Phaseolus vulgaris, l.: The Plant Encyclopedia.
  9. Garas, L. S., Uzabakiriho, J. D. & Chiwmamurombe, P. M., 2012. Isolation and identification of Fungal Species Associated with Gall Formation on Acacia mellifera in the Western Windhoek. Journal of pure and applied microbiology, 713-716.
  10. Gerlach, W. & Nirenberg, H. I., 1982. The genus Fusarium—a pictorial atlas. Mitt Biol Bundesanst Land-Forstw Berlin-Dahlem, Volume 209, pp. 1-406.
  11. Goud, J. C. & Termorshuizen, A. J., 2003. Quality of methods to quantify microsclerotia of Verticulum dahliae in soil. European journal of plant pathology, 523-534.
  12. Guarro, J., Gena, J. & Stchigel, A., 2006. Developments in Fungal Taxonomy. American Society for Microbilogy, 457-484.
  13. Hoog, S. & Guarro, J., 2000. Atlas of Clinical Fungi.
  14. Josef, H. et al., 2008. Taxonomy and phylogeny of the Fusarium dimerum species group. Mycologia, 101(1), pp. 44-70.
  15. Kang, S. et al., 2010. The promise and pitfalls of sequence-based identification of plant-pathogenic fungi and oomycetes. Phytopathology, 100(8), pp. 732-737.
  16. Kurtzman, C. P. & Robnet, C. J., 2004. Phylogenetic relationships among species of Saccharomyces, Schizosaccharomyces, Debaryomyces and Schwanniomyces determined from partial ribosomal RNA sequences.
  17. Maier, W. et al., 2014. A disease epidemic on Zizyphus mucronata in the Kruger National Park caused by Coniodictyum chevalieri. Studies in Mycology, Volume 55, pp. 279-288.
  18. Mazibuko, N., 2007. Ziziphus mucronata Willd. South African Biodiversity Institute.
  19. Mullis , K. B. & Faloona, F. A., 1987. Specific Synthesis of DNA in vitro via a polymerase-catalyzed chain-reaction. Methods in Enzymology, Volume 155, pp. 355-350.
  20. Narayanamasamy, P., 2011. Microbial Plant Pathogens-Detection and Disease Diagnosis. l.:s.n.
  21. Oerke, E. C., 1994. Crop Protrction and Crop Production.
  22. Olaguyigbe, O. O. & Afolayan , A. J., 2012. Antimicrobial Potency of the ethanolic crude bark extract of Ziziphus mucronata Willd. Academic Journals, 6(10), pp. 724-730.
  23. Salah, H. et al., 2015. Phylogenetic Diversity Of Human pathogenic Fusarium and emergence of uncommon virulent species. Journal Of Infection, 71(6), pp. 658-666.
  24. Scussel, V. M., 2000. Micotoxinas em Micotoxinas e Armazenagem de Graos. VMS, 382.
  25. Soledad, M. et al., 2009. The Phytopathogenic fungus Alternaria brassicicola: Phytotoxin production and phytoalexin elicitation.
  26. Tharreau, D., Silue, J. & Notteghem, L., n.d. Genetic Study of Host-Parasite Relationship in the Oryza Sativa-Magnaporthe Grisea Pathosystem. SpringerLink, 49-49.
  27. van Diepeningen, A. D., AL-Hatmi, A. M., Brankovics, B. & de Hoog, G. S., 2014. Taxonomy and Clinical Spectra of Fusarium Species: Where Do We Stand in 2014?. SpringerLink, 1(1), pp. 10-18.
  28. Wani , A. H., 2011. An overview of the fungal rot of tomato. Mycopath, 9(1), pp. 33-38.
  29. Zhang, S. et al., 2013. Floral transition in maize infected with Sporisorium reilianum disrupts compatibility with this biotrophic fungal pathogen. SpringerLink, 1251-1266.