Evidence of Association of Begomovirus with the Yellow Vein Disease of an Ornamental Plant Pot Marigold (Calendula officinalis) from Western Uttar Pradesh

Jitender Singh¹*, Shivani Khanna¹, Koushlesh. Ranjan²,
R.P. Pant³, Pankaj Kumar¹, Anil Sirohi¹ and V. K. Baranwal³

¹College of Biotechnology, SardarVallabhbhai Patel University of Agriculture & Technology, Meerut, Uttar Pradesh – 250110, India.
²Department of Veterinary Physiology and Biochemistry, College of Veterinary and Animal Sciences, SardarVallabhbhai Patel University of Agriculture & Technology, Meerut, Uttar Pradesh- 250110, India.
³Plant Virology unit, Division of Plant Pathology, Indian Agriculture Research Institute, New Delhi- 110012, India.

Abstract

Begomoviruses are among the most damaging pathogens causing epidemics in economically important crops particularly in tropical and subtropical regions. During February 2015, 20 samples of Calendula with yellow vein disease were collected from the campus of S. V. Patel University of Agriculture & Technology, Meerut, Uttar Pradesh, India. Total genomic DNA was isolated from the symptomatic and asymptomatic leaf samples and subjected to  PCR using coat protein gene specific primer of begomovirus. The PCR amplification of ~770bp was obtained from the 13plants out of 20collected plants. The PCR amplicon from coat protein gene was cloned, sequenced and submitted to GenBank, with accession number KT833850. The sequence data was further analyzedby BLAST analysis and phylogenetic tree was constructed using MEGA5.0 software which revealed close similarity of sequences with coat protein gene (AV1) components of other potato begomoviruses, which are all tentative strains of Tomato Leaf Curl New Delhi Virus (ToLCNDV).The result also indicated that Calendula spp. plants infected with Tomato Leaf Curl New Delhi Virus may act as an alternate host (reservoir) for other economically important plants.

Keywords: Begomovirus, PCR, ToLCNDV, Calendula officinalis.

Introduction

Begomoviruses (genus Begomovirus, family Geminiviridae) are a group of plant viruses transmitted by the whitefly Bemisiatabaci (Aleyrodidae) to a large variety of cultivated and uncultivated plant species. They possess  a circular single-stranded DNA genome encapsidated in twinned icosahedral virus particles (Rojas et al., 2005).Huge economic losses have been observed in India and other countries due to geminivirus infection in cotton (Briddon& Markham; 2000), tomato (Moffat; 1999), cassava (Thresh; 1998) and grain legumes (Verma; 1992). Begomovirus are an outsized varied family of plant viruses (Mansoor et al., 2003) which  infects an expansive assortment of plants such as ornamentals, weeds and crops and causes a noteworthy loss to agriculture and horticulture worldwide (Lima et al., 2013). More than 80% of the known geminiviruses are transmitted by whiteflies and belong to the genus Begomovirus.Mostof these viruses have bipartite genome designated as DNA-A and DNA-B and infect dicotyledenous plants.Ornamental plants are extensively scattered worldwide and have high environmental adaptability. Ornamentalplants are considered as a foundation of new viruses and are considered as reservoirs of unidentified economically imperative viruses which are often neglected during virus diversity study (Urbino et al., 2013). Many scientific reports have demonstrated that ornamental plants serve as reservoir or alternative hosts for begomovirus survival (Raj et al., 2007) and spread in the absence of the main crops (Iiyas et al., 2013). Thus, there is a pressing need for additional information on the diversity and distribution of begomovirus in ornamental plants.

Calendula officinalisL. (Asteraceae) is an important annual ornamental plant grown in gardens during the winter season and has an aesthetic beauty of bright yellow colored flower. It belongs to the family, Asteraceae, and is commonly known as Pot Marigold. The plant is native to Central and Southern Europe, Western Asia and  USA. In addition, it has a considerable importance to the cosmetic/pharmaceutical industry because of it’s used in the manufacture of antiseptic creams.

Plant viruses affect the aesthetic value of ornamental Calendula by reducing its rate of growth as well as the quality and quantity of its flowers.  Calendula officinalisplants have been found to be affected by  Cucumber mosaic virus  (Lisa & Della-Valle, 1979; Naqvi&Samad, 1985),  Turnip mosaic virus  (Lisa  et al. , 1979) and Tobacco mosaic virus  (Hristova  et al ., 1994). A rosette disease transmitted by whiteflies and grafting was recorded on C. officinalis by Gupta &Verma (1983). In the present investigation PCR and nucleic acid sequence based molecular identification and characterizationofbegomovirus associated with leaf yellow vein disease of Calendula officinaliswas done.

Materials and Methods

Sample Collection
The twentyCalendula officinalis plants showing vein yellowing, shortening of leaves and petioles, stunting of plants, reduction in growth, number and size of flowers and  asymptomatic were randomly collected from the S. V. Patel University of Agriculture and Technology, Meerut, Uttar Pradesh during February 2015 – 2016. The samples were sealed in plastic zip bags and  labelled to distinguish the identity of each sample and  stored at -20ºC for further use.

DNA extraction, PCRand cloning
The total genomic DNA was extracted from symptomatic and asymptomatic leaves of calendula plant using CTAB method (Dellaporta et al., 1983). DNA extract was allowed forPCRbased detection ofvirus using primers (TLCVAV1-F 5’CGAACCGACCAGCAGATATCA 3’ and TLCVAV1-R 5’TTTGATGCATGAGTACAGGCCA 3’) from the CP region of leaf curl virus (Singh et al., 2013).PCR amplification were carried out using a MJ Mini, Bio- Rad thermal cycler in a  25 μl reaction containing 2.5 μl 10X PCR buffer, 0.5 μl, 25 mM Mgcl2, 2.5mM each dNTPs, 20mM 1.25 μl each primers, 0.1 μlTaq DNA polymerase (Merk Bioscience Pvt. Ltd., Bengaluru, India) and 2 μl template DNA. The DNA was amplified by initial denaturation of 94 ^oC for 10 min followed by 35 cycles of 94 ^oC for 30 s denaturation, 67 ^oC for 45 s, Primer annealing, 72 ^oC for the 1 min. primer extension and final extension at 72 ^oC for 10 min. The PCRamplicons obtained were electrophoresed through 0.8% (w/v) agarose gel in 1X TAE and visualized under UV light after staining with ethidium bromide (0.5 ug mL-1). PCR amplified products of expected sizes were purified (GeneJET Gel Extration Kit, Lithuania)and ligated into the pTZ57R/T vector (Fermentas, Arlington, Canada). The recombinant vector was transformed into E.coli.strain DH5α. Selected recombinant clones were screened by PCR using same set of primers as described earlier. Restriction digestion of plasmid DNA of recombinant clones was carried out to further confirm the presence of insert in the vector.

Nucleic acid sequencing and data analysis
The selected positive clones were sequenced at the automated DNA sequencing facility, Department of Biochemistry, Delhi University, South campus, New Delhi using M13 and T7 primers (Chromus Biotech Pvt. Ltd., India).  The sequence data obtained after sequencing was then validated by performing BLAST[www.ncbi.nih.gov/BLAST] (Altschul et.al., 1990) analysis. BLAST programme of NCBI was used to analyse the sequence data and to find related begomovirus sequences forin-silico analysis (Altschulet al., 1990). Nucleotide and amino acid sequence homologies were viewed using Bioedit software 7.3. (Hall,1999). Sequence alignments were produced using Clustal W programme (Thompson et al., 1994). Phylogenetic trees were constructed based on matrices of aligned sequences using neighbour-joining algorithmof Mega 5.0 software (Tamura et al., 2011).

Results

Detection of begomovirus
The symptoms of infected Calendula officinalis  plants observed during field survey in campus of S. V. Patel University of Agriculture & Technology, Meerut were  vein yellowing, shortening of leaves and petioles, and stunting of plants, reduction in growth, number and size of flowers (Fig. 1 A & B). To identify the begomovirus associated with the disease, PCR was performed using the total DNA of infected and healthy samples with a pair of primers specific to the coat protein (CP) gene of the genus Begomovirus(Singh 2013). The electrophoresis of PCR products on 0.8% agarose gel showed the expected size (770bp) amplicons in infected samples only (Fig. 2 and 3). However,  no such amplicons were obtained in healthy samples. The PCR amplicon was cloned and sequenced and the data obtained from clones was submitted to GenBankand Accession numberKT833850 was assigned.

Fig. 1. A). Healthy Calendula plant; B). Naturally infected Calendula officinalis plant showing yellow vein net disease in field; a close view of leaf of infected plant showing severe yellow vein net symptoms

Fig. 2. Detection of ToLCV through PCR in infected calendula plants using TLCAV1-F/R. M- Molecular marker (1 Kb ladder), Lane – 1, 2, 4, 5, 6,  9, 10 & 11 : 770 bp DNA specific to coat protein region, Lane – 3, 7, 8, 12: no amplification

Sequence Analysis
BLAST search analysis of nucleotide sequence KT833850 revealed 95–98% sequence identity with variousstrains of Tomato leaf curl New Delhi virus (ToLCNDV) infecting Tomato (AB976527),Chilli (DQ029202), Pumpkin (JN129254), Luffa (HM989845), Poppy (KC513822), Potato (KC205270) from India and Black nightshade ( AJ620187), Field bindweed (KC960492), Bitter gourd (AM747291) and Tomato (DQ116883) from Pakistan and KC207815 on Luffa from South Korea.Pair-wise alignment of nucleotide (nt) and deduced amino acid (aa) sequences of the CP gene of the virus isolate in study (Accession no KT833850) with CP gene sequences of selected ToLCNDV isolates from diverse plant species, and other begomoviruseswas calculated using Bioeditprogramme. Pair-wise alignment of the virus isolate in study revealed the 95.3–98.4% identityat the nt level and 86.3 to 91.7%at aa level with various isolates of ToLCNDV (Table 1).

Fig. 3. Detection of ToLCV through PCR in infected calendula  plants from different locations using TLCAV1-F/R. M- Molecular marker (1 Kb ladder), Lane – 13, 14, 17, 18 &19: 770 bp DNA specific to coat protein region , Lane – 15, 16 & 20- no amplification

The highest identity was observed with several isolates of ToLCNDV reported from different geographical locations and different plant hosts such as tomato (AB976527), Chilli (GU831539), potato (KC205213), Tomato leaf curl New Delhi on Luffa(KC207815) from South Korea.Moreover, the phylogenetic analyses nucleotide sequences of the virus isolate showed a close relationship with various strains of ToLCNDVfrom tomato, poppy, luffa bitter guard etc.(Fig. 4).

Fig. 4. Phylogenetic tree depicting the relationship of various begomoviruses based on alignment of coat protein gene nucleotide sequences. Tree was constructed using Mega 5 programme with 1000 bootstrap values

Table 1. Coat protein gene  sequenceanalysis of the virus isolate (EF123060) based on the Basic Local Alignment Search Tool (BLAST) and sequence identity.

Discussion

Begomoviruseshave been reported from different plant species in India. In the present study, initial survey for the incidence of yellow vein disease in calendula plants showed the 65% incidence (13 out of 20 plants) in PCR assay using coat protein (CP) gene primer pair (Fig. 2 and 3). The CP gene primers were reported in successfully detection of begomovirus by PCR in several plants species (Shorab et al. 2006; Singh et al., 2007; Tiwari et al., 2012, Singh et al, 2013). Similarly, Hallan (1998) reportedbegomovirus infection in tomato plants by extracting DNA followed by amplification of coat protein region using specific primer pair. The nucleotide sequence of virus isolate was BLAST searched to identify the homologous sequences in the NCBI databases and subjectedto construct a phylogenetic treetree using Mega 5 programme(Tamura et al., 2011). The coat protein gene of ToLCV isolates showed homology of more than 95-98% with all other reported geminiviruses coat protein gene sequences form different plat hosts (Table 1). The highest homology was observed with severalisolates of ToLCNDV reported from different geographical locations and variety of plant hosts such as tomato (AB97657) and potato (KC205213).

The pairwise nucleotide sequence identity (Table 1) and phylogenetic study (Fig. 4) confirmed the causal agent of yellowvein net symptoms of Calendula officinalis as a strain of Tomato leaf curl New Delhi virus.Study also revealed that CP gene of present begomoviruses illustrates a high degreeof sequence similarity and closeness with different important crop-infecting begomoviruses.However, virus isolate did not reveal a close identity to Cotton leaf curl Rajasthana virus (NC 003199) used earlier for cross hybridisation (Chatterjee et al. 2005) and  with Mesta yellow vein mosaic virus (DQ298138) (Paul et al. 2006) (Raj et al. 2007). Yellow vein net disease of Calendula associated withCucumber mosaic virus has been reported previously (Naqvi&Samad, 1985) which belongs to a plant pathogenic virus in the family Bromoviridae. The study of theCP gene of begomovirus complex isolates from northern India and their similarity with other importantcrop-infecting begomoviruses reveals the broadened host range in India.

Khan et al., 2005 observed yellow vein net disease on several Calendula officinalis plants in Aligarh and Lucknow, region of India with similar disease symptoms consisting of vein yellowing, shortening of leaves and petioles and stunting and the infecting virus isolate was identified as a Begomovirus. Khan et al., 2007 analyzed nucleotide sequence of coat protein gene from calendula which shared maximum identities of 96–97% with four strains of Tobacco curly shoot virus (ToCSV) and an Ageratum ernation virus (AgEV) during BLAST analysis of sequence data.

Similarily, Naturally infected plants showing  yellow leaf vein netting symptoms accompanied by excessive yellowing and curling of leaves and stunting of the whole plant were reported on Ageratum houstonianum (Srivastava et al., 2015), Amaranthuscruentus  (Raj et al., 2008), Hibiscus cannabinus L (Raj et al., 2007).

The geminivirus disease complexes have wide host range within dicots plants, including vegetables and fibre crops, ornamental plants and weeds indicating there is little, if any, natural resistance in their germplasm. Widespread distribution and diversity, coupled to the global movement of plant material and dissemination of the whitefly vector, suggest that geminivirus disease complexes pose a serious threat to tropical and sub-tropical agro-ecosystems worldwide (Mansoor et al., 2003).Hence, nucleotide sequence information of the viral genes can be used for developing suitable diagnostic techniques for detection of virus at early stage in plants. Moreover, cloned modified CP components can be used to develop transgenic potato against the virus disease.

Acknowledgments

The authors acknowledge the Vice Chancellor, S. V. Patel University of Agriculture and Technology, Meerut-250110, Uttar Pradesh, Council of Science and Technology, Uttar Pradesh and Bioinformatics facility (DBT funded), India, for providing financial support and the facilities to carry out this research work.

References

1. Altschul SF, Gish W, Miller W, Myers EW, Lipman DJ. (1990)Basic local alignment search tool. J. Mol. Biol215: 403-410
2. Briddon RW, Markham PG. (2000) Cotton leaf curl virus disease.Virus Res 71:151–159.
3. Chatterjee A, Roy A, Padmalatha KV, Malathi VG, Ghosh SK. (2005) Occurrence of a Begomovirus with yellow vein mosaic disease of mesta (Hibiscus cannabinus and Hibiscus sabdariffa). Australas. Plant Pathol. 34 :609-610
4. Dellaporta SL, Wood J, Hicks JB. (1983) A plant DNA minipreparation: version II. Plant MolBiol Report 1:19–21
5. Gupta M, Verma VS. (1983) Calendula rosette disease. Gartenbauwissenschaft 48, 106–107.
6. Hall TA. (1999)BioEdit: a user-friendly biological sequence alignment editor and analysis program for Windows 95/98/NT. Nucleic Acids Symp. Ser. (Oxf.) 41:95–98
7. Hallan VK. (1998) Genomic organization of geminivirus causing leaf curl on tomato. PhD Thesis. Lucknow University, Lucknow (IN).
8. Hristova D, BarkerdzhievaN, Svrakov K. (1994) Tomato mosaic virus isolated from Calendula offi Conference on Plant Virology 32, 153.
9. Ilyas M, Nawaz K, Shafiq M, Haider MS, Shahid AA. (2013)Complete nucleotide sequences of two begomoviruses infecting Madagascar periwinkle (Catharanthusroseus) from Pakistan. Arch Virol 158: 505–10.
10. Khan AA, Naqvi QA,Singh R,Raj SK. (2005). First report of a begomovirus infecting Calendula in India. Plant Pathology 2005 Vol.54 No.4 pp.569 ref.2 DOI:1111/j.1365-3059.2005.01220.x
11. Khan AA, Khan MS, Raj SK, Naqvi, QA. (2007) Molecular identification of a begomovirus causing yellow vein disease on Calendula officinalis in india. Bulletin 37: 420-426.
12. Lima AT, Sobrinho RR, González-Aguilera J, Rocha, CS, Silva, SJ, Xavier CA, Silva FN, Duffy S, Zerbini FM. (2013) Synonymous site variation due to recombination explains higher genetic variability in begomovirus populations infecting non-cultivated hosts. J Gen Virol 94: 418–31.
13. Lisa V, Della-Valle G. (1979) Isolation of two viruses from Calendula offi InformatoreFitopatologico 29:11–12.
14. Mansoor S, Briddon RW, Zafar Y, Stanley J. (2003)Geminivirus disease complexes: An emerging threat. Trends Plant Sci 8: 128-134.
15. Moffat AS. (1999) Geminiviruses emerge as serious crop threat. Science 286, 1835.
16. Naqvi QA, Samad A. (1985) Purification and properties of Calendula yellow net virus. Indian Journal of Virology 1:143–146.
17. Paul S, Ghosh R, Roy A, Mir JI, Ghosh SK. (2006) Occurrence of a DNA b -containing begomovirus associated with leaf curl disease of kenaf (Hibiscus cannabinus L.) in India. Australasian Plant Disease Notes 1: 29-30.
18. Raj SK, Khan MS, Snehi SK, Kumar S, Khan AA. (2007) Natural occurrence of a Begomovirus on Dimorphotheca sinuate in India. Australasian Plant Disease Notes 2: 25–26.
19. Raj SK, Snehi SK, Kumar S, Khan MS, Pathre U. (2008) First molecular identification of a begomovirus in India that is closely related to Cassava mosaic virus and causes mosaic and stunting of Jatrophacurcas L. Australas Pant. Dis. Notes 3: 69–72
20. Rojas MR, Hagen C, Lucas WJ, Gilbertson RL (2005) Exploiting chinks in the plant’s armor: evolution and emergence of geminiviruses. Annu Rev Phytopathol 43:361–394.
21. Singh DK, Islam MN, Choudhury NR, Karjee S, Mukherjee SK. (2007) The 32 kDa subunit of replication protein A (RPA) participates in the DNA replication of Mung bean yellow mosaic India virus (MYMIV) by interacting with the viral Rep protein. Nucleic Acids Res 35 755–770
22. Singh J, Singh A, Kumar P, Rani A, Barnwal VK, Sirohi A, Bhatnagar SK, Singh D, (2013) Evidence of association of a tomato leaf curl New Delhi virus with chilli leaf curl disease in western Uttar Pradesh, India. Vegetos 26(2): 203-211
23. Shorab SS, Mandal B, Ali A, Varma A. (2006) Molecular diagnosis of emerging begomovirus diseases in cucurbits occurring in northern India.Indian J Virol 17:88–95.
24. Srivastava A, JaidiM, Kumar S. et al. (2015) Molecular identification of a new begomovirus associated with leaf crumple disease of Jatrophacurcas L. in India ArchVirol 160: 617.
25. Thresh JM, Otim-Nape GW, Thankappan M, Muniyappa V. (1998) The mosaic diseases of cassava in Africa and India caused by whitefly-borne geminiviruses. Review of Plant Pathology 77:935-945.
26. Tiwari AK, Snehi SK, Singh R, Raj SK, Rao GP, Sharma PK. (2012) Molecular identification and genetic diversity among six begomovirus isolates affecting cultivation of cucurbitaceous crops in Uttar Pradesh, India. Archives of Phytopathology and Plant Protection 45(1):62-72
27. Tamura K, Peterson D, Peterson N, Stecher G, Nei M, Kumar S. (2011)MEGA5: Molecular Evolutionary Genetics Analysis using Maximum Likelihood, Evolutionary Distance and Maximum Parsimony Methods. Molecular Biology and Evolution 28(10): 2731-2739.
28. Thompson JD, Higgins DG, Gibson TJ. (1994) CLUSTAL W: improving the sensitivity of progressive multiple sequence alignment through sequence weighting, position specific gap penalties and weight matrix choice. Nucleic Acids Res 22(22): 4673-80.
29. UrbinoC, Gutiérrez S, Antolik A, Bouazza N, Doumayrou J, Granier M, Martin DP, (2013) Within-host dynamics of the emergence of tomato yellow leaf curl virus recombinants. PLoS ONE. 8: e58375.z