Research Article | Open Access
Thikra Abdullah Mahmood1 , Heider Hemeed Abbas2 and Saif Jabbar Yasir3
1Department of Community Medicine, College of Medicine, University of Kufa, Kufa, Iraq.
2Basic Medical Sciences, University of Babylon, Babil, Iraq.
3Department of Medical Microbiology, Faculty of Medicine, University of Kufa, Kufa, Iraq.
J Pure Appl Microbiol. 2020;14(2):1609-1617 | Article Number: 5996
https://doi.org/10.22207/JPAM.14.2.59 | © The Author(s). 2020
Received: 14/12/2019 | Accepted: 24/06/2020 | Published: 29/06/2020
Abstract

Epstein-Barr virus (EBV) plays the most important role in various types of human cancers. Patients receiving chemotherapy have low white blood cell (WBC) counts that elevate the risk of infection and is the first public health priority in Iraq. WBCs are capable of tumor destruction and aid in combatting infection; they also promote tumor growth, metastasis and chemotherapy resistance. Low WBC count makes the body more predisposed to infection. Our study sought to investigate the relationship between low WBC count and EBV infection in cancer patients. A cross-sectional study was performed using 120 samples obtained from cancer patients, who had a low WBC count and were receiving chemotherapy. The study included samples from 60 males and 60 females aged between 7 and 80 years from Najaf / Iraq. Among the different cancer types, breast cancer cases were high (24 patients; 20%); additionally, a high number of cancer patients (52; 43.3%) also had a low WBC count (≤2 to ≥4 in 109 / L of cells). There were no significant differences in the serological detection of positive cases for viral capsid protein IgM and EBNA-1 and EBNA-2 nuclear genes (P˃0.05) between the cancer patients of different age groups and genders. EBV infection is associated with a low WBC count in cancer patients receiving chemotherapy. No significant differences for patients was observed with respect to age and gender.

Keywords

Epstein-Barr virus infection, Serology, Immunoblotting, Avidity IgG, Epstein-Barr virus-DNA

Introduction

Epstein-Barr virus (EBV) belongs to the gammaherpesvirus subfamily that exclusively infects humans1-3. Various human tumors, such as the nasopharyngeal carcinoma and Burkett’s lymphoma (BL) are related to the actions of the EBV4,5. Viral nuclear antigens (EBNAs) and 3 latent membrane proteins are expressed in the target cells during the latent stage of infection. EBNA is a complex of at least 6 proteins6. EBNA-1 is responsible for the replication of EBV nucleic acids in the infected cells7. EBNA-2 has a role in B lymphocyte growth transformation, a function which is closely interrelated to transactivation of viral and cellular gene expression8.

The normal range for white blood cell (WBC) counts varies with age and pregnancy. Healthy childhood to reach adult levels of 4,500 to 11,000 / mm3 (4.5 to 11.0 × 109 / L; 95% confidence interval (C.I.)9. The life cycle of WBC includes differentiation and development, loading migration within the vascular spaces of the bone marrow, and migration to tissues10. Following maturation, 80-90% of WBCs remain in the bone marrow for storage. This great back upper mist for a rapid increase in the circulating WBC count within hours. A relatively small pool (2–3%)of WBC circulate liberally in the peripheral blood11,12, the rest settle along the spleen or the margins of the walls of blood vessels. Majority of the life span of leukocytes is spent in storage. Notably, once a leukocyte is released into circulation and peripheral tissues, its life span ranges from 2-16 days depending on the cell type13.

The different types of WBCs are associated with a variety of diseases including hypersensitivity, tuberculosis, fungal infections, EBV infection, protozoa infections, leukopenia, Rickettsia, whooping cough, and acute or chronic leukemia14, 15. Numerous tumors may stimulate the granulocytes-macrophage or spinal cord16. Laboratory analysis can aid in diagnosing previous and/or recent EBV infections by examining the presence of antibodies associated with the resulting EBV antigens17. This includes the detection of IgG antibodies against the viral capsule antigen (VCA), which appears at the time of onset of clinical symptoms of acute infection and remains positive for life. The anti-VCA IgM antibodies appear at the same time as the anti-VCA IgG but usually disappear within a few weeks; notably, anti-VCA IgM can persist for several months following infection in some cases18,19. Early antigen-EA and EBV nuclear antigen-EBNA20. Apart from detecting past and present viral infections, laboratory analysis can also help in deciphering if an individual is predisposed to viral infections21.

WBCs are produced in the bone marrow and have a rapid growth, that is very sensitive to the effects of chemotherapy. Toxic effect of chemotherapy on the bone marrow may cause a decrease in the WBC count; certain medications can cause defects in the bone marrow as well22. Chemotherapy also destroys numerous cells of the bone marrow23. A decrease in circulating WBCs, with a total count that is less than 3.0 × 109/L, is referred to as leukopenia25. WBCs serve as protection against bacterial and viral infections as well as other diseases. Hence, leukopenia is associated with a greater risk of infection when compared with individuals who have normal WBC counts24. Notably, not all cancer patients undergoing chemotherapy suffer from leukopenia.

Various techniques have been utilized in detecting EBV nucleic acids and measuring its DNA load26. PCR and RT-PCR have been applied to differences in specificity and sensitivity27. Real-Time PCR was very advantageous for confirming infection status, particularly of immunocompromised patients28,29, as their viral load is higher than that of healthy and carrier individuals30. The viral load declines following therapy31. A search for EBV nucleic acid is beneficial in EBV-related tumor patients, who show low blood levels for the virus because of the blood-brain barrier30,32. EBV nucleic acid from apoptotic tumor cells have been identified in the plasma, serum33,34, and latently-infected tumor cells35.

This research is aimed at identifying Epstein-Barr virus in cancer patients receiving chemotherapy, and subsequently determining the white blood cell counts of the patients based on age and genders.

Materials and Methods

In this study, 120 cancer patients receiving chemotherapy were recruited. The patients suffered with various types of cancers including, 24 breast cancer, 19 leukemia, 18 lymphoma, 10 lung cancer, 10 colorectal cancer, 7 oropharyngeal cancer, 8 hepatocellular (liver) cancer, 5 bladder cancer, 5 brain cancer, 5 ovarian cancer, and 10 rare types of cancer cases. The age group of patients ranged between 25 and 64 years old. Blood samples were collected from patients during the period between October, 2018 and September, 2019. Samples were taken from the Central Euphrates Hospital oncology and cancer in Kufa, Al-Najaf province/Iraq. All official approvals were obtained from the hospital administration and participating patients after informing them of the purpose of the research. Patients were excluded if they were pregnant, had a newborn, underwent splenectomy, smoked or were taking medications.

Study design
A cross- sectional study was performed, wherein the sample size was calculated using the equation of the study type.

Data collection
To obtain the necessary data, 5 ml of blood was withdrawn from the cancer patients. The blood samples were divided into two parts. The first portion was used for conducting a serological examination by separating out the serum from the sediment by centrifugation. Conversely, the second part was placed in EDTA tubes to conduct molecular diagnosis and determine the WBC count. A complete blood count (CBC) test with a peripheral smear may supply useful information, such as WBC maturity, type, and uniformity.

Techniques
Viral capsid proteins detection
All laboratory diagnoses were performed using each of the study sample. The diagnoses required the use of EBV-VCA IgM, VCA IgG, and EBV-1 antigen cortical antigens to determine previous or recent infections. VCA IgM is required to test the semi-automatic ELISA test group (DIESSE®, Germany) to assess positive and negative detection of VCA IgM and IgG antibodies in the 120 serum samples that were collected from male (n = 60) and female (n = 60) cancer patients receiving chemotherapy in the Al-Najaf province. It appears that the anti-VCA IgM antibodies present at the time of acute EBV infection usually disappear within 4–6 weeks. Anti-VCA IgG was used to investigate the duration of a chronic EBV infection; anti-VCA IgG levels peak at 2–4 weeks after the onset of the disease, decreases slightly and then persists for the rest of the person’s life. Patients were ready for EBV infection if they did not have VCA antibodies38. Clinical outcomes of infectious mononucleosis infection were tracked in conjunction with the emergence of anti-VCA IgM and IgG antibodies. However, an unsTable antibody pattern was regarded as an early symptom of EBV infection39.

EBNA detection
DNA extraction
DNA specimens in whole blood samples were collected from patients undergoing chemotherapy and were extracted using a kit (Roche Diagnostics Gmb H, Mannheim, Germany) as previously reported40,41.

Amplification of viral DNA
PCR was carried out on a 3Prime Thermal Cycler, Techno Thermo cycler.

PCR cycles were performed as follows: 1) initial denaturation at 95°C for 5 min, 2) 35 cycles of denaturation at 95°C for 45 s each, 3) annealing at 56°C, 4) second annealing step at 72°C for 45 s and 5) elongation at 72 °C for 1 min. Finally, following a 10 min elongation step, the samples were cooled to 4°C and visualized on a 2% (w/v) agarose gel42,43.

Data analysis
Statistical analysis was performed using the DNA Star software (version 10.0). A chi-squared (X2) test was performed to define the distribution of EBV in patients. Significance was set at value < 0.05. Statistical analyses were performed using SPSS 22.

Constant
The study was approved by the Medical Ethics Committee at the Medical faculty/ University of Kufa.

RESULTS

The population distribution of the 120 cancer patients receiving chemotherapy in the Al-Najaf Governorate was determined. Among the 120 patients, 30 patients were 7–25 years old (25%); 27 patients were 26–44 years old (22.5 %); 35 patients were 45–63 years old (29.2%) and 28 patients were 64–82 years old or older (23.3%) (Table 1). Cancer patients were found to be most commonly aged between 45 and 63 years old (29.2%) for both males and females, as shown in Table 2.

Table (1):
The sequence of the primers (Synthesized by Bioneer).

Name of primer size (bp) Sequence(5′-3′)(F: Forward, R: Reverse) Analyzed region(B95-8 coordinates) Product
EBNA-1  F TGATAACCATGGACGAGGAC 108 057–108 076 139
EBNA-1  R GCAGCCAATGCAACTTGGAC
EBNA-2  F AGGCTGCCCACC CTG AGGAT 108 176–108 195 168
EBNA-2  R 5-GCCACCTGGCAGCCCTAAAG

Table (2):
Distribution of patients with cancer (n=120) by age group.

Age groups per years
NO. of cases
(%)
7-25
30
25.0
26-44
27
22.5
45-63
35
29.2
64-82
28
23.3
Total
120
100

Table 3 shows the distribution of patients based on the cancer type. The most common cancer type with a high percentage occurrence was determined to be breast cancer (20%) in the city. This was followed by the moderately occurring leukemia (15%), lymphoma (15%), lung cancer (8.3%) and colorectal cancer (8.3%). The less common cancers included bladder, brain and ovarian cancers (4.2% each).

Table (3):
Distribution of patients with types of cancer(n=120) from male and female.

Parameters
Type of cancer No. of cases (%)
Breast cancer 24 20.0
Leukemia 19 15.8
Lymphoma 18 15.0
Lung cancer 10 8.3
Colorectal cancer 10 8.3
Oropharyngeal cancer 7 5.8
Hepatocellular (Liver) Cancer 8 6.7
Bladder cancer 5 4.2
Brain cancer 5 4.2
Ovarian Cancer 5 4.2
Rare types of cancer 10 8.3
Total 120 100

The distribution of cancer patients on the basis of WBC count is shown in Table 4. At 95% C.I., the WBC count (in 109/L cells) was normal or more specifically equal to or greater than 4 in 43.3% of the patients. Additionally, 31.7% and 25% of patients had a WBC count (in 109/L cells) of 2-3 and less than or equal to 2, respectively.

Table (4):
Distribution of patients cancer by count of white blood cells (WBC).

Count of WBC (109 / L
Cancer Cases
No.(%)
Normal count (109/L)
95% confidence interval
≤  2
30(25.0%)
4.0 – 11
2-3
38(31.7%)
4.0 – 11
≥4
52(43.3%)
4.0 – 11
Total
120(100%)
4.0 – 11

95% confidence interval

Serological determination
EBV VCA IgM were used to detect any previous or recent EBV infection in female patients. They were required to conduct a serological assay to determine if the patients were positive or negative for the anti-VCA IgM. The sera of 60 female cancer patients receiving chemotherapy were collected. The coefficients of variation for VCA IgM were 33.3%, 46.2%, 44.4%, and 42.8% for patients aged 7-25, 26-44, 45-63 and 64-82 years, respectively. No significant differences were observed between the different age groups and the coefficients of variation for VCA IgM in females (P ≥ 0.05), as shown in Table 5.

Table (5):
Serological identification of (VCA IgM ) by age groups of female patients.

Age groups
(years)
No. of
cases
VCA IgM
positive
VCA IgM
negative
P value
25-Jul 15(25.0%) 5(33.3%) 10(66.7%)  

 

0.895

 

 

26-44 13(21.7%) 6(46.2%) 7(53.8%)
45-63 18(30.0%) 8(44.4%) 10(55.6%)
64-82 14(23.3%) 6(42.8%) 8(57.1%)
Total 60(100%) 25(41.7%) 35(58.3%)

 

EBV VCA IgM was required to conduct an anti-VCA IgM ELISA to determine whether male cancer patients had been recently infected with EBV by assessing if they were positive for the anti-VCA IgM. The sera of 60 male cancer patients receiving chemotherapy were utilized. The coefficients of variation for the VCA IgM assay were 64.6%, 53.8%, 55.6% and 57.1% for patients aged 7-25, 26-44, 10 (55.6%) and 8 (57.1%) years, respectively. No significant differences in the coefficients of variation for anti-VCA IgM were observed between males in different age groups (P ≥ 0.05), as shown in Table 6.

Table (6):
Serological identification of (VCA IgM) by age groups of male cases.

Age group (years) Cancer  cases VCA IgM positive VCA IgM negative P value
No.(%)
25-Jul 15(25.0%) 7(64.6%) 8(53.3%) 0.942
26-44 13(21.7%) 7(53.8%) 6(46.2%)
45-63 18(30.0%) 10(55.6%) 8(44.4%)
64-82 14(23.3%) 8(57.1%) 6(42.9%)
Total 60(100%) 32(53.3%) 28(46.7%)

 

EBNA-1 and EBNA-2 were used to perform sequential dilutions to asses if the patients were positive or negative with respect to anti-VCA IgM. The clinical results of 60 samples derived from female cancer patients undergoing chemotherapy were obtained. Serological identifications of EBNA-1 and EBNA-2 were quantified and grouped by age. Females aged 7-25, 26-44, 45-63 and 64-82 years were determined to have 15 (25.0%), 13 (21.7%), 18 (30.0%) and 14 (23.3%) EBNA-1 and EBNA-2 levels, respectively. No significant differences in the serological EBNA-1 and EBNA-2 levels were detected between the various age groups (P˃ 0.05), as indicated in Table 7.

Table (7):
Serological identification of (EBNA1,EBNA2) depending on age groups of female patients.

Age groups
(years)
Cancer
cases
No.(%)
 
ENBA 1
 
EBNA 2
P value
positive negative positive negative
25-Jul 15(25.0%) 5(33.3) 10(66.7%) 5(33.3) 10(66.7%) 0.98
26-44 13(21.7%) 6(46.2%) 7(53.8%) 5(38.5%) 8(61.5%) 0.785
45-63 18(30.0%) 8(44.4%) 10(55.6%) 6(33.3% 12(66.7%) 0.366
64-82 14(23.3%) 5(35.7%) 9(64.3%) 4(28.6%) 10(71.4%) 0.50
Total 60(100%) 24(40.0%) 36(60.0%) 20(33.3%) 40(66.7%)  
P value 0.864 0.96

 

The presence of EBNA-1 and EBNA-2 was detected by performing sequential dilutions of positive and negative samples concerned with anti-VCA IgM. Clinical results were obtained from 60 samples that were collected from male cancer patients. Serological levels of EBNA-1 and EBNA-2 in males aged 7-25, 26-44, 45-63 and 64-82 years were found to be 15 (25.0%), 13 (21.7%), 18 (30.0%) and 14 (23.3%) respectively. No significant differences were observed between the various age groups of male patients (P˃ 0.05).

Table (8):
Identification of EBNA1, EBNA2 depending of age groups of male cases.

Age group
(years)
Cancer Cases
No.(%)
EBNA1 EBNA2 P value
positive negative positive negative
25-Jul 15(25.0%) 6(40.0%) 9(60.0%) 4(26.7%) 11(73.3%) 0.3499
26-44 13(21.7%) 7(53.8%) 6(46.2%) 6(46.2%) 7(53.8%)) 0.783
45-63 18(30.0%) 10(55.6%) 8(44.4%) 9(50.0%) 9(50.0%) 0.747
64-82 14(23.3%) 7(50.0%) 7(50.0%) 6(42.9%) 8(57.1%) 0.775
Total 60(100%) 30(50.0%) 30(50.0%) 25(41.7%) 35(58.3%)
P value 0.826 0.539

 

Dissection
The current study provides an analysis of the relationship between low WBC count, which is defined as less than 4,000 / mm3 (4.0 × 109/ L), and cancer patients receiving chemotherapy; we discovered several novel findings. In our study, the highest number of cancer patients (35 patients; 29.2%) were aged between 45 and 63 years among both males and females; this is discordant with previous findings44. Adult cancer patients with a low WBC count that are aged between 45 to 63 years remain susceptible to primary EBV infection. Additionally, 30 (25.0%) cancer patients were between the ages of 7 and 25 years; this is in agreement with findings suggesting that infections in children are asymptomatic, but present with symptoms in infected teenagers45. The misdiagnosis of primary EBV infection in smaller and young children is attributed to atypical laboratory findings.A factor that is related to EBV infection is the cancer type. The highest number of patients from Najaf city that were included in our study suffered from breast cancer (24 patients; 20.0%). Other studies have reported EBV infection in 26.37% (95% CI: 22–31%) of the 44 patients included in the study46; hence, this indicates a strong statistical relationship between EBV infection and breast cancer.

In our study, EBV infected 52/120 (43.3%) cancer patients with low WBC; the incidence rate is ≥4 (4.0 × 109 per L). EBV was previously reported to be prevalent in 26.37% (95% C.I.; 22–31%) of the 44 included patients46. This association may be correlated with nutritional status as protein deficiencies could lead to a compromised immune system Age is one of the most important risk factors for cancer patients with low WBC count. Our study found no significant (p ˃0.05) difference between EBV infection and low WBC in cancer patients receiving chemotherapy on the basis of gender and age. This result is in disagreement with previous findings48,49. Previous studies have shown that female cancer patients are more susceptible to infection compared to male cancer patients50,51; additionally, cancer patients receiving chemotherapy were also previously reported to temporarily suffer from a low WBC count, which returns to normal after a few days. During this period, patients have a chance of being infected by viruses. The adults patients may have reduced bone marrow, renal and hepatic function, and complication arising from other treatments.

Moreover, negative anti-EBV VCA IgM and IgG test indicates that the patient has no immunity; conversely, if a patient tests positive for anti-EBV VCA IgM antibodies and positive or negative for the VCA IgG antibody, the result is interpreted and indicates that the person has an acute infection or is at the non-specificity phase. If the anti-EBV VCA IgM antibodies test is negative and the VCA IgG test is positive, the patient is considered to have been affected by infection. This is in accordance with previous findings52.

The distribution of the EBV among cancer patients receiving chemotherapy was investigated due to immunosuppressive effects of chemotherapy. Significance was set at P value < 0.05 and the findings are in agreement with previous reports37,53. Viruses can reactivate from the latent phase when cancer patients or host undergo an immune impairment.

EBNA-1 is known as a faint multifunctional viral protein that binds with EBV54. It is the only EBV protein found in all malignant tumors associated with EBV55,56. It is important in creating and maintaining the changing state of cells while developing EBV57. EBNA-1 contains a recurrent chain of glycine and alanine residues that separates the protein into amino and carboxylic peripheral bands57. This sequence also appears to stabilize the protein and prevent its breakdown, while also weakening antigen processing and major histocompatibility complex (MHC)-associated antigen presentation. Consequently, CD8-cytotoxic T cells associated with CD8 are prevented from responding against HIV-infected cells58. EBNA-1 is expressed from the Qp promoter during all transition time programs57 It is the only viral protein expressed in the first latency program54,58.

EBNA-2 is one of six EBV viral nuclear proteins expressed in infected B lymphocytes, a protein modulus. EBNA-2 is involved in the regulation of latent viral transcription and contributes to immortalized EBV-infected cells58,59. EBNA-2 acts as a conversion molecule that binds to DNA binding proteins of cell sequences, recombinant signal binding protein JK (RBP-JK) and PU.1; it also works with multiple members of the RNA polymerase transcription complex59.

CONCLUSION

Epstein–Barr virus infection has been related to a low white blood cell count in cancer patients receiving chemotherapy. No significant differences in Epstein–Barr virus infection were observed between patients in terms of age and gender and between both virus strains.

Declarations

ACKNOWLEDGMENTS
We would like to thank all the staff of laboratory of Medical City.

CONFLICT OF INTEREST
The authors declare that there is no conflict of interest.

AUTHORS’ CONTRIBUTION
This work was carried out in collaboration among all authors. SJY is responsible for collecting samples and assessment each one; TAM making all official statistical analysis; HHA is responsible for reviewing the research. All authors read and approved the final manuscript.

FUNDING
None.

ETHICS STATEMENT
This work approved by ethical committee of University of Kufa.

AVAILABILITY OF DATA
The data that involved in this study are included in the manuscript and presented as Tables and figures.

References
  1. Maylin S, Feghoul L, Salmona M, et al. Evaluation the Architect EBV VCA IgM, VCA IgG, and EBNA-1 IgGchemiluminescent immunoassays to assess EBV serostatus prior transplantation. PubMed, J Med Virol. 2017;89(11):2003-2010.
    Crossref
  2. Tselis A, Jenson HB, eds. Epstein-Barr Virus. Taylor and Francis, New York, NY. Rickinson AB, Kieff. Epstein-Barr Virus. In Fields Virology, 5thEdition, Knipe. 2006.
    Crossref
  3. Aitken C, Sengupta SK, Aedes C, Moss DJ, Sculley TB. Heterogeneity within the Epstein-Barr virus nuclear antigen 2 gene in different strains of Epstein-Barr virus.J Gen Virol. 1994;75(Pt 1):95-100.
    Crossref
  4. Tselis A, Jenson HB, eds. Epstein-Barr Virus. Taylor and Francis, New York. 2006.
    Crossref
  5. Rickinson AB, Kieff. Epstein-Barr Virus. In Fields Virology, 5thEdition, Knipe DM and Howley PM, eds, Wolters Kluwer/Lippincott Williams & Wilkins, Philadelphia, PA, Chapter 68B. 2007.
  6. Leight ER. Sugden B. EBNA-1: a protein pivotal to latent infection by Epstein-Barr virus. Rev Med Virol. 2000;10:83-100.
    Crossref
  7. American Cancer Society website. Infections in people with cancer. www.cancer.org/treatment/treatments-and-side-effects/physical-sideeffects/infections/infections-in-people-with-cancer.html. Updated February 25, 2015. Accessed May 2, 2019.
  8. Centers for Disease Control and Prevention website. Preventing infections in cancer patients. www.cdc.gov/cancer/preventinfections/index.htm. Updated November 28, 2018. Accessed May 2, 2019.
  9. Zhang, XN, Dawson CW, He AW, Huang PC. Immune evasion strategies of the human gamma-herpesviruses: implications for viral tumorigenesis. ExternalJ Med Virol. 2012;84(2):272-81.
    Crossref
  10. CDC. Epidemiologic Notes and Reports Burkitt’s Lymphoma-Winchester, Virginia. MMWR. 1997;46(29):674-68.
  11. CDC. Pseudo-Outbreak of Infectious Mononucleosis—Puerto Rico, 1990. MMWR. 1991;40(32):552-5.
  12. Molyneux EM, Rochford R, Griffin B, Newton R, Jackson G, Menon G. Burkitt’ slymphoma External. Lancet.2012;379(9822):1234-1244.
    Crossref
  13. Balkwill F, Mantovani A. Inflammation and cancer: back to Virchow? [see comment] Lancet. 2001;357:539-545.
    Crossref
  14. Mantovani A, Schioppa T, Porta C, Allavena P, Sica A. Role of tumor-associated macrophages in tumor progression and invasion. Cancer Metastasis Rev.2006;25:315-322.
    Crossref
  15. Sica A, Schioppa T, Mantovani A, Allavena P. Tumour-associated macrophages are a distinct M2 polarised population promoting tumour progression: potential targets of anti-cancer therapy. Eur J Cancer.2006;42:717-727.
    Crossref
  16. Thorley-Lawson DA, Geilinger K. Monoclonal antibodies against the major glycoprotein (gp350/220) of Epstein-Barr virus neutralize infectivity. Proc Natl Acad Sci USA. 1980;77:5307-5311.
    Crossref
  17. Schillinger M, Kampmann M, Henninger K, Murray G, Hanselmann I, Bauer G. Variability of humoral immune response to acute Epstein-Barr virus (EBV) infection: evaluation of the significance of serological markers. Med Microbiol Lett. 1991;2:296-303.
  18. Evans AS, Niederman JC, Cenabre LC, West B, Richards VA. A prospective evaluation of heterophile and Epstein-Barr virus-specific IgM antibody tests in clinical and subclinical infectious mononucleosis: Specificity and sensitivity of the tests and persistence of antibody. J Infect Dis. 1975;132:546-554.
    Crossref
  19. Crawford J, Wolff DA, Culakova E, et al. First cycle risk of severe and febrile neutropenia in cancer patients receiving systemic chemotherapy: results from a prospective nationwide study. Blood. 2004;104:607a-608a
    Crossref
  20. Moss DJ, Burrows SR, Khanna R. EBV: immunobiology and host response. In Human Herpesviruses: Biology, Therapy and Immunoprophylaxis. 2012.
  21. Maylin S, Feghoul L, Salmona M, et al.. Evaluation the Architect EBV VCA IgM, VCA IgG, and EBNA-1 IgGchemiluminescent immunoassays to assess EBV serostatus prior transplantation MMWR. 2018;46(29):674-678.
  22. Yarnell JW, Patterson CC, Sweetnam PM, Lowe GD. Haemostatic/inflammatory markers predict 10-year risk of IHD at least as well as lipids: the Caerphilly collaborative studies. [see comment] Eur Heart J. 2004;25:1049-1056.
    Crossref
  23. Brown DW, Ford ES, Giles WH, Croft JB, Balluz LS, Mokdad AH. Associations between white blood cell count and risk for cerebrovascular disease mortality: NHANES II Mortality Study, 1976-1992. Ann Epidemiol. 2004;14:425-430.
    Crossref
  24. Maltoni M, Caraceni A, Brunelli C, Broeckaert B, Christakis N, Eychmueller S. Prognostic factors in advanced cancer patients: evidence-based clinical recommendations–a study by the Steering Committee of the European Association for Palliative Care. J ClinOncol.2005;23:6240-6248.
    Crossref
  25. Vidal L, Ben Dor I, Paul M, Eliakim-Raz N, Pokroy E, Soares-Weiser K, Leibovici L. Oral versus intravenous antibiotic treatment for febrile neutropenia in cancer patients. Cochrane Database Syst Rev. 2013;(10):CD003992.
    Crossref
  26. Chan KH, Ng MH, Seto WH, Peiris JS. Epstein-Barr virus (EBV) DNA in sera of patients with primary EBV infection. J Clin Microbiol. 2001;39:4152-4154.
    Crossref
  27. Preti M, Rotondo JC, Holzinger D, et al. Role of human papillomavirus infection in the etiology of vulvar cancer in Italian women. Infect Agent Cancer. 2020;15:20. PMID:32266002.
    Crossref
  28. Rotondo JC, Bononi I, Puozzo A, et al..Merkel Cell Carcinomas Arising in Autoimmune Disease Affected Patients Treated With Biologic Drugs, Including Anti-TNF. Clin Cancer Res. 2017;23(14):3929-3934. PMID: 28174236.
    Crossref
  29. Luderer R, Kok M, Niesters HG, Schuurman R, de Weerdt O, Thijsen SF. Real-time Epstein-Barr virus PCR for the diagnosis of primary EBV infections and EBV reactivation. Mol Diagn. 2005;9:195-200.
    Crossref
  30. Fan H, Kim SC, Chima CO, et al. Epstein-Barr viral load as a marker of lymphoma in AIDS patients. J Med Virol. 2005;75:59-69.
    Crossref
  31. Stevens SJ, Smits PH, Verkuijlen SA, et al. Aberrant Epstein-Barr virus persistence in HIV carriers is characterized by anti-Epstein-Barr virus IgA and high cellular viral loads with restricted transcription. AIDS. 2007;21:2141-2149.
    Crossref
  32. Fellner MD, Durand K, Correa RM, et al. Circulating Epstein-Barr virus (EBV) in HIV-infected patients and its relation with primary brain lymphoma. Int J Infect Dis. 2007;11:172-178.
    Crossref
  33. Ambinder RF, Lin L. Mononucleosis in the laboratory. J Infect Dis. 2005;192:1503-1504.
    Crossref
  34. Culakova E, Thota R, Poniewierski MS, et al. Patterns of chemotherapy-associated toxicity and supportive care in US oncology practice: a nationwide prospective cohort study. Cancer Med. 2014;3:434-444.
    Crossref
  35. Kimura H, Ito Y, Suzuki R, Nishiyama Y. Measuring Epstein-Barr virus (EBV) load: the significance and application for each EBV-associated disease. Rev Med Virol. 2008;18:305-319.
    Crossref
  36. Jia Y, Wang Y, Chao Y, Jing Y, Sun Z, Luo B. Sequence analysis of the Epstein-Barr virus (EBV) BRLF1 gene in nasopharyngeal and gastric carcinomas. Virol J. 2010;7:341.
    Crossref
  37. http://www.ncbi.nlm.nih.gov/ BLAST (National Center for Biotechnology Information; http://www.ncbi.nlm.nih.gov/)
  38. Luka J, Chase RC, Pearson G. A sensitive enzyme-linked immunosorbent assay (ELISA) against the major EBV-associated antigens. J Immunol Methods. 1984;67:145-149.
    Crossref
  39. Page last reviewed: Selected Morbidity and Mortality Weekly Report (MMWR) Articles. 2018.
  40. Sugiura M, Imai S, Tokunaga M, et al. Transcriptional analysis of Epstein-Barr virus gene expression in EBV-positive gastric carcinoma: unique viral latency in the tumour cells. Br J Cancer. 1996;74:625-631.
    Crossref
  41. Ikuta K, Satoh Y, Hoshikawa Y, Sairenji T. Detection of Epstein-Barr virus in salivas and throat washings in healthy adults and children. Microbes Infect. 2000;2:115-120.
    Crossref
  42. Jin Y, Xie Z, Lu G, Yang S, Shen K. Characterization of variants in the promoter of BZLF1 gene of EBV in nonmalignant EBV-associated diseases in Chinese children. Virolo J. 2010;7:92.
    Crossref
  43. kwangheekim, eunmeehan, eungseok lee, hongseok park, insunkim, young-sikkim. Departments of Pathology, and Urology, Korea University Ansan Hospital, Ansan, Korea, and Department of Medicine, Albert Einstein College of Medicine, Bronx, NY. 2005.
  44. Schmader KE, van der Horst CM, Klotman ME. Epstein-Barr virus and the elderly host. Rev Infect Dis. 1989;11:64-73.
    Crossref
  45. Auwaerter PG. Infectious mononucleosis in middle age.JAMA. 1999;281:454-459.
    Crossref
  46. Farahmand M, Monavari SH, Shoja Z, Ghaffari H, Tavakoli M, Tavakoli A. Epstein-Barr virus and risk of breast cancer: a systematic review and meta-analysis. US National Library of MedicineNational Institutes of Health. 2019;15(24):2873-2885.
    Crossref
  47. Weycker D, Li X, Edelsberg J, et al. Risk of febrile neutropenia in patients receiving emerging chemotherapy regimens. 2014.
    Crossref
  48. Halevy J, Ash S. Infectious mononucleosis in hospitalized patients over forty years of age. Am J Med Sci.1988;295:122-124.
    Crossref
  49. Crighton M, Puppione A. Geriatric neutrophils: implications for older adults. Semin Oncol Nurs. 2006;22:3-9.
    Crossref
  50. Balducci L, Hardy CL, Lyman GH. Hemopoiesis and aging. Cancer Treat Res. 2005;124:109-134.
    Crossref
  51. Wardwell L, Chapman-Novakofski K, Herrel S, Woods J. Nutrient intake and immune function of elderly subjects. J Am Diet Assoc. 2008;108:2005-2012.
    Crossref
  52. Wang X, Wang Y, Wu G, Chao Y, Sun Z, LuoB. Sequence analysis of Epstein-Barr virus EBNA-2 gene coding amino acid 148-487 in nasopharyngeal and gastric carcinomas. Virology Journal. 2012;9049.
    Crossref
  53. Epstein-Barr virus and its association with disease – a review of relevance to general practiceBMC Family Practice. 2019;200.
  54. Humme, Siblille, et al. “The EBV nuclear antigen 1 (EBNA1) enhances B cell immortalization several thousandfold”. PNAS. 2003;100(19):10989-10994.
    Crossref
  55. Duellman Sarah J, Katie L. Thompson, Joshua J Coon, Richard R Burgess. “Phosphorylation sites of Epstein–Barr Virus EBNA1 regulate its function”. J Gen Virol. 2009;90(9):2251-2259. PMID19439552.
    Crossref
  56. Young Lawrence S, Alan B Rickinson. “Epstein–Barr Virus: 40 Years On”. Nature Reviews Cancer. 2004;4(10):757-768. PMID15510157.
    Crossref
  57. Levitskaya J, Coram M, Levitsky V, et al. “Inhibition of antigen processing by the internal repeat region of the Epstein–Barr virus nuclear antigen-1”. Nature. 1995;375(6533):685-688. PMID7540727.
    Crossref
  58. Henkel T, Ling PD, Hayward SD, Peterson MG. “Mediation of Epstein-Barr virus EBNA2 transactivation by recombination signal-binding protein J kappa”. Science. 1994;265(5168):92-95. PMID8016657.
    Crossref
  59. Wu DY, Kalpana GV, Goff SP, Schubach WH. “Epstein-Barr virus nuclear protein 2 (EBNA2) binds to a component of the human SNF-SWI complex, hSNF5/Ini1”. J Virol. 1996;70(9):6020-6028. PMC190622. PMID 8709224.
    Crossref

Article Metrics

Article View: 9225

Share This Article

© The Author(s) 2020. Open Access. This article is distributed under the terms of the Creative Commons Attribution 4.0 International License which permits unrestricted use, sharing, distribution, and reproduction in any medium, provided you give appropriate credit to the original author(s) and the source, provide a link to the Creative Commons license, and indicate if changes were made.