Research Article | Open Access

Hiba Sabah Jasim

Department of Microbiology, Medicine College, University of Baghdad, Iraq.
J Pure Appl Microbiol, 2019, 13 (1): 441-446 | Article Number: 5450
Received: 11/12/2018| Accepted: 24/01/2019 | Published: 25/03/2019
Abstract

DNA methylation is one of the epigenetic changes that may affect cell functions, which associated with several steps of cancer progression. Gastric carcinoma is endemic in Iraq with highly association of Epstein Barr Virus infections.  Epigenetic changes for gastric carcinoma diagnosis are very important to early diagnose the disease also consider as biomarker to search of the progression of cancer. So detection of methylation of early genes in Epstein barr virus associated gastric carcinoma is very useful to confirm the diagnosis of the disease. The first step is detection of the virus in the fresh and embedded tissues, then search of the methylation pattern of the early genes of the virus that expressed several important proteins that effect the life cycle if the virus also the progression of the disease using conventional polymerase chain reaction. The virus was detected in 20% of tissue samples, while the methylation state was positive in 87.5% in tissues affected with the virus. Highly percentage of the methylation in the early genes of the virus may affect the virus infection which will affect the progression of the cancer.

Keywords

DNA methylation, Epigenetic change, Epstein barr virus, virus early genes, gastric carcinoma.

Introduction

Epstein Barr virus (EBV) is a ubiquitous herpes DNA virus with an incidence of approximately 90% in the general population and may remain asymptomatic for the whole life of the patient1. The major targets of EBV infections are the B lymphocytes and epithelial cells. EBV was associated with several human tumors, such as oral cancer, lymphomas and gastric cancer2. The EBV type that infects gastric tissue and may cause cancer is a critical type with an incidence of nearly 12% of all gastric carcinomas in the general population. The virus considered one of the causative agents of gastric cancer, and has a major effect in oncogenic persistent3.

The gene expressions of the EPV play an important role in the tumor progression. The virus has three latency stages: stage one, two and three, by the patterns of the expression of the virus genes. In gastric carcinoma latency stage one or two were responsible of latent infection, which produce several viral oncogenic genes4.Viral genes expression modifies relying on the state of the tumors and the tissue of origin5. Additionally, the latent gene stage could be inhibiting by methylation. This methylation might be a reaction of the host immune system versus obtrusive DNA; however, the methylation state could be useful to the virus by let it fleeing from the host immune system3. Epigenetic alteration such as DNA methylation has important role in the regulation of the transcription of that DNA and this may lead to the progression of the   tumorigenesis6.

Early genes of the virus such as Bam HI-A rightward ORF one (BARF1) and Bam HI-H rightward ORF one (BHRF1), have very important function in the pathogenesis of this virus, as BARF1 encode (c-fms) which is an oncogene protein and BHRF1 encodes the (Bcl-2) which is an antiapoptotic gene. BARF1 plays a major role in the lytic cycle of the virus and it considered an oncogene agent in cancer cases playing a critical function in the progression of cancer in the stomach7. The oncogenic effect of this ORF could convert the epithelial cells and induce the production of (Bcl-2), this situation make cells permanence in unsuitable states8.

Methylation pattern of the BARF1 promoter was confirm in different cell lines in epithelial caners, and the CpGs of this promoter were methylated mostly. This suggests that BARF1 duplication must ride methylation-induced inhibition9. In the lytic stage of the EPV, BHRF1 has a critical function in the replication cycle and viral particles liberation, as it produce the oncogene Bcl-2, which has an important function in the viral pathogenesis. The transcription of BHRF1 indicates a potential service in the preservation of the persistent of infection of this virus10,11.

In this study, I select number of gastric carcinoma samples to survey the methylation pattern of early genes BARF1 and BHRF1 and their role in effecting the production of corresponding genes.

Materials and Methods

A total of 140 fresh gastric and paraffin embedded tissue samples were included in this study, one hundred of these samples from gastric carcinoma patients (60 samples were fresh gastric tissue, and the other forty samples were taken from patients blocks as paraffin embedded tissue) as patients group, while the control group was 40 fresh gastric biopsies obtained from apparently healthy people whom visit the hospital suffering from gastric ulcers so they considered negative control as this group was not diagnosed with any type of cancer, all samples were precede to the series examination and tests of this study, starting from the extraction of the DNA until the final step of the examination.

DNA was extracted from both paraffin embedded and fresh tissues using the standard method and according to the manufacture instruction of the two kits were used. QIAamp DNA of formalin fixed paraffin embedded tissue kit used to obtain the DNA from embedded samples while the DNA of the fresh samples was extracted by QIAamp fresh tissue kit.

Then the quality and integrity of the DNA was checked using housekeeping genes , GAPDH primer gene, samples gave positive results after PCR amplification with this primer set as the program of  Rameshkumar et al.12 and produce bands of 240 bp considered of good quality and further complete the other tests of this study, while other samples which gave negative results in this amplification were excluded from the study as the quality of these samples was bad, the number of excluded samples was 20 (six from fresh patients and 14 from the paraffin embedded tissues).

Then PCR amplification was done to detect the EBV, the master mix was prepared with total volume 25 µl per one reaction containing 10 pmol forward and reverse primers, 2.5 U Go Taq ® DNA polymerase, 200 µM of each dNTP, 1X of 5 X Green Go Taq reaction buffer, then nuclease free water was added until the volume reach 23 µl, finally 2 µl of genomic DNA was added, the primers were directed to conserved regions of EPV encoding capsid protein gp220 and EPV nuclear antigen (EPNA1), the primer sets sequences were illustrated in table 1.

Table (1):
EPV primer sets and the product size [13]

EPV primer sets
Sequence
Product size
gp220 forward
GGCTGGTGTCACCTGTGTTTA
239 bp
Reverse
CCTTAGGAGGAACAAGTCCC
EPNA1 forward
GTCATCATCATCCGGGTCTC
269 bp
Reverse
TTCGGGTTGGAACCTCCTTG

DNA Bisulfite Treatment and Methylation Analysis
Samples show positivity in the previous two amplifications was further continuing to bisulfite modification of DNA according to Sodium bisulfite modification of DNA14 In 50 µl water, add 2 µl of genomic DNA to 6 µl of NaOH at 38°C for 9 minutes, then incubation conditions was 32 µl of 12 mM hydroquinone and 530 µl of sodium bisulfite at 52°C for 15 hour in dark conditions. Then, purification of DNA with nuclear free water using the Cleanup Kit. Finally DNA incubated at 25 for 7 minutes; precipitation of DNA with 2 µl of glycogen, washed with 70% ethanol; then resuspended in distilled water.

After treatment and modification of DNA, methylation pattern of BARF1 and BHRF1 genes was detected using methylation specific polymerase chain reaction, using the primer sets that illustrated in table 2.

Table (2):
Sequences of the primer sets for the methylation specific polymerase chain reaction (MSP) used in this study [15]:

BARF1
Methylation
Forward
GTTGGATTTAGTTATTTTGTCGTTC
 
Reverse
TTATCATATAAACCTAAAACCCGTA
BARF1
Un methylation
Forward
GTTGGATTTAGTTATTTTGTTGTTTG
 
Reverse
TTATCATATAAACCTAAAACCCATA
BHRF1
Methylation
Forward
TTTGTATATTTGGTTAGTTGATCGA
 
Reverse
CGAAACGTAATACTTCCTAAAAACG
BHRF1
Un methylation
Forward
TTTGTATATTTGGTTAGTTGATTGA
 
Reverse
CCCAAAACATAATACTTCCTAAAAACA

Then methylation specific PCR products were resolved on two percentage  gel, the results examined by comparing the product sizes of each sample with the product size of each primer sets, if a band present with 142 bp by using methylation primer set of BARF1 gene this indicate positive results for methylation to this gene, additionally the un methylated primer sets for the same gene was of 142 bp product size also  and if the band appear this means negative results and there was no methylation state in the BARF1 gene, while the other gene results was readied by the appearance of a band of 218 bp for the methylation primer set of BHRF1 means positive results and the methylation state was appear, and the appearance of a band of 220 bp for un methylated primer set means negative results and there was no methylation in the BHFR1 gene.

RESULTS

A total of 140 samples were submitted to check the quality of their DNA; 20 samples were excluded because the quality of their DNA was low as demonstrated in table 3.

Table (3):
Classification of samples included in this study

Patients group
 
 
 
Total number of patients samples after exclusion
Control group
Fresh samples
Paraffin embedded  tissue
Number of samples
Number of excluded samples
Number of samples
Number of excluded samples
 

60

 

 

6

 

40

 

14

 

80

 

40

Epstein Barr virus positive results was detected in 24/120 of the samples which represented 20%, the virus was detected in 18 sample in the fresh samples group, and detected in 6 samples in the paraffin embedded tissue samples group, these results was be demonstrated in the table 4.

Table (4):
Detection of the Epstein Barr Virus

Positive
%
Negative
%
Total
Patients group
Fresh

samples

18
33.3
36
66.7
54
 
Paraffin embedded

samples

6
23.1
20
76.9
26
Control group
0
0.0
40
100
40
Total
24
20
96
80
120

The methylation state appear in high incidence in the samples that was detected with the EBV, as the methylation was detected in 87.5 % from the cases, these results was demonstrated in table 5.

Table (5):
Methylation status in EBV associated gastric carcinoma

Patients group
Positive (methylated)
%
Negative (non-methylated)
%
Total
Fresh samples
 

16

 

88.9

 

2

 

11.1

 

18

Paraffin embedded samples
 

5

 

83.3

 

1

 

16.7

 

6

Total
21
87.5
3
12.5
24
Discussion

Epigenetic changes such as DNA methylation are recognized as an important mechanism in cancer initiation and progression16. Epstein Barr Virus infection induces increased genome-wide gene methylation, resulting in the formation of a unique type with high CpG methylation in tumor cells. Given its important functions in cancer initiation and progression, DNA methylation is being explored as a biomarker for cancer17.

The open reading frame BARF1 is a potent oncogene in EBV carcinomas and has a variety of important biological functions in the pathogenic and carcinogenic mechanism of this virus18 BARF1 had been reported to be expressed in EBV-positive gastric cancer tissues during latency and was considered as oncogenic, parallel to the more widely studied latent membrane protein 1 (LMP1)19. Especially in EBV-positive GC, BARF1 is expressed in the absence of LMP1, possibly functioning as an EBV oncogene in this disease and playing an important function for developing of gastric carcinoma caused by EBV20. Expression of BARF1 gene during lytic replication is regulated by the immediate early proteins BRLF1 and is independent of the promoter methylation status21. The methylation status of BARF1 promoter may play an important role in cancer progression during latency infection of the virus. The open reading frame BHRF1 similar to Bcl-2 in its function as it inhibits apoptosis of the B lymphocytes and epithelial cells. In vitro studies showed that BHRF1 could enhance cell resistance to apoptosis and cell death caused by many external factors, such as foreign virus infection22. In this study, I explored the CpG methylation profiles of EBV early genes in the gastric cancers caused by this virus after bisulfite treatment using conventional PCR.

The result of the methylation of the early genes of EPV in this study considered high with an incidence of 87.5 %, this result was higher than the result of the methylation in the same early genes in a study done in China using quantitative real time PCR, these differences in the result may be because of the geographical distribution, also the difference in the molecular technique that used in both studies as the conventional PCR was used in this study.

Acknowledgments

None

Conflict of Interest

The authors declare no conflict of interest.

References
  1. Young L, Yap L, and Murray P. Epstein-Barr virus: more than 50 years old and still providing surprises. Nature Reviews: Cancer, 2016; 16(12): 789–802.
  2. Jha H, Pei Y, and Robertson E. Epstein-Barr virus: diseases linked to infection and transformation. Frontiers in Microbiology, 2016; 7: 1602.
  3. Shinozaki A, Kunita A, and Fukayama M. Update on Epstein-Barr virus and gastric cancer (review). International Journal of Oncology, 2015; 46(4): 1421–1434.
  4. Jang B, Jung E, and Kim W. Expression of Bam HI-A rightward transcripts in Epstein-Barr virus-associated gastric cancers. Cancer Research and Treatment, 2011; 43(4): 250–254.
  5. Murata T, Noda C, and Narita Y. Induction of Epstein-Barr virus oncoprotein LMP1 by transcription factors AP-2 and early B cell factor. Journal of Virology, 2016; 90(8): 3873–3889.
  6. Decaussin G, Lammali F, Turenne M, Bouguermouh A, and Ooka T. Expression of BARF1 gene encoded by Epstein-Barr virus in nasopharyngeal carcinoma biopsies. Cancer Research, 2000; 60(19): 5584–5588.
  7. Zhang C, Decaussin G, Daillie J, and Ooka T. Altered expression of two Epstein-Barr virus early genes localized in Bam HI-A in non-producer Raji cells. Journal of Virology, 1988; 62(6): 1862–1869.
  8. Takada K. Role of EBER and BARF1 in nasopharyngeal carcinoma (NPC) tum-origenesis. Seminars in Cancer Biology, 2012; 22(2): 162–165.
  9. Hoebe E, Wille C, E. and Hopmans E. Epstein-Barr virus transcription activator R upregulates BARF1 expression by direct binding to its promoter, independent of methylation. Journal of Virology, 2012; 86(20): 11322–11332.
  10. Liu M, Shih Y, and Li L. Expression of the Epstein-Barr virus BHRF1 gene, a homologue of Bcl-2, in nasopharyngeal carcinoma tissue. Journal of Medical Virology, 2000; 61(2): 241–250.
  11. Luo B, Wang Y, and Wang X. Expression of Epstein-Barr virus genes in EBV-associated gastric carcinomas. World Journal of Gastroenterology, 2005; 5: 629–633.
  12. Rameshkumar K, Clark D J. Efficient extraction of DNA from paraffin- embedded tissue using nucleon HT kit for clinical molecular pathology research. Life Science News: Biosciences: 1998.
  13. Telenti A, Marshall W , Smith T . Detection of Epstein Barr Virus by polymerase chain reaction. Journal of clinical microbiology, 1990; 28(10): 2187-2190.
  14. Hashimoto K, Shimizu Y, Suehiro Y. Hypermethylation status of APC inversely correlates with the presence of sub-mucosal invasion in laterally spreading colorectal tumors. Mol Carcinogen 2008; 47: 1–8.
  15. Jing L, Wen L, Kui C. The methylation status and expression of Epstein Barr Virus early genes BARF1 and BHRF1 in Epstein Barr Virus associated gastric carcinomas. Hindawi gastroenterology research and practice. 2017, Article ID 3804146.
  16. Jones P, Baylin S. The fundamental role of epigenetic events in cancer. Nat Rev Genet. 2002; 3(6): 415–28.
  17. Fukayama M, Ushiku T. Epstein-Barr virus-associated gastric carcinoma. Pathol Res Pract. 2011; 207(9):529–37.
  18. Sheng W, Decaussin G, Ligout A, Takada K, and Ooka T. Malignant transformation of Epstein-Barr virus-negative Akata cells by introduction of the BARF1 gene carried by Epstein-Barr virus. Journal of Virology, 2003; 77(6): 3859–3865.
  19. Decaussin G, Sbih F, Turenne M, Bouguermouh A, and Ooka T. Expression of BARF1 gene encoded by Epstein-Barr virus in nasopharyngeal carcinoma biopsies. Cancer Research, 2000; 60(19): 5584–5588.
  20. Hoebe E, Le Large E, Greijer A, and Middeldorp J. BamHI-A rightward frame 1, an Epstein-Barr virus-encoded oncogene and immune modulator. Reviews in Medical Virology, 2013; 23(6): 367–383.
  21. Hoebe E, Wille C, and Hopmans E. Epstein-Barr virus transcription activator R upregulates BARF1 expression by direct binding to its promoter, independent of methylation. Journal of Virology, 2012; 86(20): 11322–11332.
  22. Dawson C, Eliopoulos A, Dawson J, and Young L. BHRF1, a viral homologue of the Bcl-2 oncogene, disturbs epithelial cell differentiation. Oncogene, 1995; 10(1): 69–77.

Article Metrics

Article View: 4800

Share This Article

© The Author(s) 2019. Open Access. This article is distributed under the terms of the Creative Commons Attribution 4.0 International License which permits unrestricted use, sharing, distribution, and reproduction in any medium, provided you give appropriate credit to the original author(s) and the source, provide a link to the Creative Commons license, and indicate if changes were made.