Research Article | Open Access
Marwa A. Yakout and Ibrahim A. Abdelwahab
Department of Microbiology and immunology, Faculty of Pharmacy, Pharos University in Alexandria, Egypt.
J Pure Appl Microbiol. 2022;16(1):138-146 | Article Number: 7397
https://doi.org/10.22207/JPAM.16.1.02 | © The Author(s). 2022
Received: 28/10/2021 | Accepted: 03/12/2021 | Published online: 03/01/2022
Issue online: March 2022
Abstract

During the different waves of the coronavirus (COVID-19) pandemic, there has been an increased incidence of diabetes mellitus and diabetic foot infections. Among gram-negative bacteria, Pseudomonas aeruginosa is the predominant causative agent for diabetic foot ulcer infections in low-resource countries. P. aeruginosa possesses a variety of virulence factors, including biofilm formation. Biofilm formation is an important benchmark characteristic in the pathophysiology of diabetic foot ulceration. The main objective of the current study was to identify the most commonly isolated organisms and their antibiotic susceptibility patterns in diabetic foot patients during the COVID-19 pandemic. We also determined the genes associated with bacterial persistence and biofilm formation in the predominantly isolated organism. Accordingly, 100 wound swab samples were collected from diabetic foot patients from different hospitals in Alexandria, Egypt. Through phenotypic detection of biofilm formation, 93% (40) of the 43 P. aeruginosa isolates examined were categorized as biofilm producers. Molecular detection of the biofilm-encoding genes among the 43 P. aeruginosa isolates was as follows: algD (100%), pelF (88%) and pslD (49.7%), and this highlights a need for biofilm formation inhibitors to prevent the persistence of bacterial pathogens, and thus achieve better clinical outcomes in diabetic foot ulcer infections.

Keywords

Diabetic foot ulcer infections, Pseudomonas aeruginosa, biofilm, COVID-19

Introduction

According to the International Diabetes Federation, there has been an increased incidence of diabetes mellitus (DM) during the different waves of the coronavirus (COVID-19) pandemic.1-4 A study in Wuhan reported that diabetic patients constituted 2–20% of all positive cases, and accounted for 7.1% of intensive care unit admissions.5,6 Another study in New York reported that 33.8% of COVID-19 positive patients were diabetic. Accordingly, several reports have attempted to determine the reason for the correlation between COVID-19 and DM. One hypothesis is that the angiotensin-converting enzyme 2 (ACE2) receptor necessary for the entry of SARS-CoV-2 is overexpressed in diabetic patients taking antidiabetic medications.5,7-9 In addition, the use of corticosteroids in COVID-19 patients increases blood glucose levels in both diabetic and non-diabetic individuals.5,10 Additionally, diabetic patients are more vulnerable to viral and bacterial infections.5, 11 The COVID-19 pandemic has posed many challenges for the diabetic community, such as lack of sufficient resources, overworked health care workers, and scarcity of proper care for diabetic patients to avoid the development of infections.12, 13

Diabetic foot ulcer (DFU) is a common complication of DM, with an increasing prevalence worldwide.14 Thirty-three percent of all diabetic patients are expected to be diagnosed with DFUs at least once during their lifetime. Untreated DFUs can result in leg amputations, permanent disability, and increased mortality rates in DM patients.13 DFUs are most commonly associated with clinical infections with different etiological agents.15-22 Microbiological studies have shown that diabetic foot ulcers generally have polymicrobial etiologies. The etiological agent may differ from one individual to another, and from country to country. Aerobic gram-positive bacteria that are frequently isolated in DFUs include Staphylococcus spp. beta-hemolytic Streptococcus and Enterococcus spp. Escherichia coli, Proteus mirabilis, and Klebsiella pneumoniae are among the gram-negative bacteria that are most commonly isolated in DFUs.23 P. aeruginosa is the predominant causative agent for DFUs in low-resource countries.15-22 Pseudomonas spp. are generally encountered in immunocompromised patients due to their high pathogenicity and variety of virulence factors, including biofilm formation.24 Virulence factors and biofilm formation are the benchmark characteristics in the pathophysiology of DFUs.25 The formation of biofilms by bacteria is considered to be the cornerstone that provides bacteria protection against several environmental factors, mediates persistence in medical devices, facilitates immune system evasion, and contributes to the development of antimicrobial resistance.15,21,22 Antibiotic resistance is a global public health concern, especially in patients with diabetic foot infections (DFIs). Multidrug resistance results in poor clinical outcomes, financial burden, and increased morbidity and mortality in DFU patients.23

The main objective of the current study was to identify the commonly isolated organisms and their antibiotic susceptibility patterns in DFU patients during the COVID-19 pandemic. In addition to phenotypic detection of biofilms, we also determined genes encoding biofilm formation in the predominantly isolated organism.

Materials and Methods

One hundred wound swab samples were collected from DFU patients at the Vascular Surgery and Diabetic Foot Unit of Abou Hommos Central Hospital, Alexandria Main University Hospital, Mowasat Hospital, Abou Qir Central Hospital, and Medical Research Institute, in Alexandria, Egypt, between January 2020 and January 2021. The study was approved by the Ethics Committee in Pharos University in Alexandria, and all procedures were performed according to Helsinki ethical standards. Specimens were subjected to Gram staining, and were cultured in mannitol salt agar, MacConkey agar, blood agar, and Sabouraud dextrose agar (Oxoid, Cambridge, UK). Isolates were identified using standard biochemical methods,26 and P. aeruginosa isolates were confirmed with MALDI-TOF/MS (Bruker, Billerica, MA, USA). The identified stock cultures were preserved at −80 °C in 15% glycerol.

Antimicrobial susceptibility test
Antibiotic susceptibility tests were done by disc diffusion method on Mueller–Hinton agar plates (Oxoid) according to Clinical Laboratory Standards Institute (CLSI) 2019 guidelines.26 The antibiotic discs include: Ceftazidime (CAZ, 30 μg), Cefepime (FEP, 30 μg), Piperacillin-tazobactam (TZP, 100 μg/ 10 μg), Aztreonam (ATM, 30 μg), Levofloxacin (LEV, 5 μg), Amikacin (AMK, 30 μg), Azithromycin (AZM, 15 μg), Erythromycin (E, 15 μg), Gentamycin (CN, 10 μg), Tetracycline (TE, 30 μg), Cefoxitin (FOX, 30 μg), Chloramphenicol (C, 30 μg), Ampicillin (AMP, 10 μg), Imipenem (IPM, 10 μg), Linezolid (LZD, 30 μg), Amoxicillin-clavulanate (AMC, 20 μg/10 μg), and Methicillin (MET, 5 μg).

Quantification of Biofilm formation by P. aeruginosa
200 µL of overnight broth subculture of the tested isolates in sterile trypticase soy broth (TSB) (Oxoid), equivalent to 1.5×108 CFU/mL, was added to each well of a 96-well flat-bottomed microtiter plate, in triplicates. The plates were then incubated at 35 °C for 24 h. The next day, the medium was discarded, and the wells were washed with phosphate-buffered saline (PBS, pH 7.2) (Sigma-Aldrich, Milan, Italy). Biofilm fixation was performed by incubating the 96-well plates at 60 °C for 1 h. 0.1% (w/v) Crystal violet was used for staining, and was extracted with 99.5% ethanol.27 The optical density (OD) value of each well was measured at 620 nm on a microtitre plate ELISA reader (STATFAX2100, Fisher Bioblock scientific, France). The isolates were characterized according to their biofilm-forming ability as strong, moderate, weak, or non-biofilm producers, as previously described by Stepanovic et al.28

Molecular detection of biofilm encoding genes in P. aeruginosa
DNA was extracted from the P. aeruginosa isolates using the boiling method.29 DNA amplification was performed using Master Mix (iNtRON biotechnology, Seongnam, South Korea). The primers30 (SBS GeneTech, Beijing, China) and the annealing temperatures used are listed in Table 1. PCR program was as follows: initial denaturation at 95 °C for 5 min, followed by denaturation at 95 °C for 1 min, 30 cycles at 58 °C for algD, pelF and 56 °C for pslD gene for 40 seconds, then 72 °C for 45 seconds, and a final elongation at 72 °C for 5 min.

PCR products were separated on 2% agarose gel in TBE buffer, stained with 2 μg/mL ethidium bromide, and visualized under ultraviolet transillumination (BIORAD, Italy).30,31

Table (1):
Primers used for detection of genes involved in Biofilm formation by Pseudomonas aeruginosa.

Gene
Primers
Annealing Temperature
Band Size
algD
F-CTACATCGAGACCGTCTGCC
R-GCATCAACGAACCGAGCATC
58
593
pelF
F-GAGGTCAGCTACATCCGTCG
R-TCATGCAATCTCCGTGGCTT
58
789
pslD
F- TGTACACCGTGCTCAACGAC
R- CTTCCGGCCCGATCTTCATC
56
369

Statistical analysis
Statistical analysis of the data was performed using IBM SPSS software version 20.0. (IBM Corp, Armonk, NY, USA). The chi-square test and Fisher’s exact test were used. Statistical significance was set at a p-value of 5% or lower.

RESULTS

The present study included swabs from 100 DFU patients (75 male and 25 female) admitted to the Vascular Surgery and Diabetic Foot Unit of Abou Hommos Central Hospital, Alexandria Main University Hospital, Mowasat Hospital, Abou Qir Central Hospital, and Medical Research Institute, Alexandria, Egypt, between January 2020 and January 2021. The ages ranged from 44 to 76 years.

Microbiological Culture Results
The microbiological culture of the 100 DFU swabs yielded monomicrobial bacterial growth in 76 samples (76%), polymicrobial bacterial growth (2–3 microorganisms) in 20 samples (20%), and Candida albicans in 4 samples (4%) (Table 2).

Table (2):
Culture results of 100 diabetic foot ulcers.

Growth pattern in culture No. %
Bacterial growth 96 96.0
Monomicrobial 76 76.0
Polymicrobial microorganism (2 – 3) 20 20.0
Fungal growth
Candida albicans 4 4.0
Total 100 100.0

The microbial species isolated from the DFU specimens are listed in Table 3. The majority of the isolates were gram-negative (88%), and P. aeruginosa was the predominant gram-negative bacteria isolated (43%), followed by K. pneumoniae (21%), P. mirabilis (11%), E. coli (9%), and Serratia marcescens (4%). The gram-positive bacteria isolated were S. aureus (5%) and Enterococcus spp. (2%). C. albicans was the only fungal species isolated (5%).

Table (3):
Frequency of microbial isolates from 100 diabetic foot ulcers.

Gram reaction No. %
Gram-negative P. aeruginosa 43 43.0
K. pneumoniae 21 21.0
P. mirabilis 11 11.0
E. coli 9 9.0
Serratia marcescens 4 4.0
Gram-positive S. aureus
Enterococcus spp.
5
2
5.0
2.0
Fungi C. albicans 5 5.0
Total 100 100.0

Antibiotic Susceptibility Profile
Antibiotic susceptibility in the forty-three P. aeruginosa isolates was as follows: Ampicillin (100%), followed by Aztreonam (74%), Amikacin (72%), Levofloxacin, Amoxicillin-clavulanate (69.7%), Cefoxitin (46.5%), Ceftazidime (41%), Imipenem (32.5%), and varied degrees of resistance to other antibiotics (Table 4).

Table (4):
Resistance profile of the tested isolates to different antimicrobial agents.

Name of microorganism Total No. of isolates Antibiotics % of Resistance
AZM E ATM IPM FEP CAZ AMC AMP TZP LEV CN AMK FOX MET C LZD TE
Pseudomonas aeruginosa 43 32(74.0) 14(32.5) 12(27.9) 18(41.0) 30(69.7) 43(100.0) 11(25.5) 30(69.7) 30(69.7) 31(72.0) 20(46.5)
Klebsiella pneumoniae 21 12(57.1) 5(23.0) 7(33.3) –9(42.0) 16(76.0) 20(95.2) 8(38.0) 16(76.0) 15(71.4) 16(76.0) 9(42.0) 9(42.0)
Proteus mirabilis 11 8(72.0) 2(18.0) 0(0.0) 1(9.09) 2(18.0) 7(63.0) 7(63.0) 7(63.0) 2(18.0) 6(54.0) 8(72.0) 8(72.0) 8(72.0)
Escherichia coli 9 3(33.0) 2(22.0) 5(55.0) 6(66.0) 5(55.0) 2(22.0) 7(77.0) 6(66.0) 6(66.0) 6(66.0) 3(33.0) 3(33.0)
Serratia marcescens 4 0(0.0) 0(0.0) 0(0.0) 1(25.0) 0(0.0) 0(0.0) 0(0.0) 0(0.0) 0(0.0) 0(0.0)
Staphylococcus aureus 5 2(40.0) 2(40.0) 1(20.0) 1(20.0) 4(80.0) 1(20.0) 0(0.0) 4(80.0)
Enterococcus spp. 2 0(0.0) 0(0.0) 0(0.0) 1(50.0) 0(0.0) 0(0.0) 0(0.0)

Antibiotic susceptibility profile of the twenty-one K. pneumoniae isolates was as follows: Ampicillin (95%), followed by Amoxicillin-clavulanate, Levofloxacin and Cefoxitin (76%), Amikacin (71.4%), Aztreonam (57.1%), and varied degrees of resistance to other antibiotics. The eleven P. mirabilis isolates were resistant to Aztreonam, Cefoxitin, Cefazolin and Chloramphenicol (72%), Ampicillin, Piperacillin-tazobactam and Levofloxacin (63%), Amikacin (54%), and varied degrees of resistance to other antibiotics. Of the nine E. coli isolates, 77% were resistant to levofloxacin, followed by amoxicillin-clavulanate, gentamycin, amikacin and cefoxitin (66%), and ampicillin (55%). Four isolates of S. marcescens were resistant to ampicillin (25%) (Table 4).

Of the five S. aureus isolates, 96% were resistant to tetracycline and methicillin and with varying degree of resistance to other antibiotics. Of the two Enterococcus spp. isolates, 50% were resistant to cefoxitin, as shown in Table 4.

Quantification of Biofilm formation by P. aeruginosa
Of the forty-three P. aeruginosa isolates examined, twenty-three (53.5%) were strong biofilm producers, ten (23.2%) were moderate biofilm producers, seven (16.3%) were weak biofilm producers, and just three isolates (7%) were non-biofilm producers.

Molecular detection of Biofilm encoding genes in P. aeruginosa
The following genes encoding biofilm exopolysaccharides were identified in the 43 P. aeruginosa isolates: algD (100%), pelF (88%) and pslD (49.7%). The presence of algD, pslD, and pelF genes was noted in a large proportion of the 43 P. aeruginosa isolates. Our findings revealed that 82.6 % of the 23 strong biofilm producers had the genotypic pattern algD +/pslD +/pelF +, while the rest were algD −/pslD −/pelF −. On the other hand, 66.6% of the three non-biofilm producers carried the biofilm encoding genes, as shown in Table 5.

Table (5):
Relationship between phenotypic biofilm characteristic and genotypic biofilm characteristic among P. aeruginosa isolates (Manual).

Phenotypic pattern of biofilm, no. (%) Genotypic pattern of biofilm, no. (%) χ2 FEp
AlgD +/pslD +/pelf + AlgD -/pslD /pelf
Strong 23 (53.5%) 19 (82.6%) 4 (17.4%) 0.953 0.473
Moderate 10 (23.2%) 7 (70%) 3 (30%) 0.332 0.674
Weak 7 (16.3%) 5 (71.4%) 2 (28.6%) 0.132 0.656
Non 3 (7%) 2 (66.6%) 1 (33.4%) 0.184 0.558
Total 33 10

χ2:  Chi-square test; FE: Fisher Exact
p: p-value for comparing between the studied groups

DISCUSSION

DFU is a debilitating consequence of DM with an increasing prevalence worldwide.14 During the different waves of the COVID-19 pandemic, DM was increasingly diagnosed worldwide. Based on the recommendation of the International Diabetes Federation, increased care should be given to diabetic patients to avoid the devastating complications of DM.1-4 Among the hypothesized reasons contributing to the increased incidence of DFIs during the COVID-19 pandemic is the increased expression of the ACE2 receptor necessary for the entry of SARS-CoV-2 in diabetic patients.5,7-9 Other reported reasons include the rise in blood glucose levels noted in patients receiving corticosteroids.5,10 Additionally, diabetic patients are more vulnerable to viral and bacterial infections.5,11 Other challenges contributing to the increased incidence of DFIs include a lack of sufficient resources, overworked health care workers, and a scarcity of proper care for diabetic patients to avoid the development of infections.13

The present study included swab samples from 100 patients with DFUs (75 male and 25 female). Other studies have also supported the male predominance of foot ulceration and its associated complications.32,33 Culture results of the 100 specimens showed 76% monomicrobial bacterial growth, 20% polymicrobial bacterial growth, and 4% fungal growth. Hitam et al. also reported a similar percentage (28.8%) of polymicrobial infections in DFI patients.34 Additionally, culture results showed that the majority of isolates were gram-negative (88%) bacteria, and P. aeruginosa was the predominant microorganism isolated (43%), followed by K. pneumoniae (21%), P. mirabilis (11%), E. coli (9%), and S. marcescens (4%). Among gram-positive bacteria, S. aureus was the most common isolate. Pseudomonas spp. was regarded as the main causative agent of DFI by Hitam et al.,34 Hatipoglu et al.,35 Hobizal et al.,36 and Ramakant et al.37 P. aeruginosa is also reported to be the most predominant causative agent for DFIs in low-resource countries.15-22 P. aeruginosa should not be regarded as a normal flora in burn wounds and diabetic foot patients. P. aeruginosa can cause extensive tissue damage in diabetic patients and result in sepsis.24 Additionally, S. aureus has been reported to be the most common gram-positive etiological pathogen of DFI.34-37

Antibiotic susceptibility testing revealed that 100% of the forty-three P. aeruginosa isolates were resistant to Ampicillin, followed by Aztreonam (74%), Amikacin (72%), Levofloxacin, Gentamycin and Amoxicillin-clavulanate (69.7%), Cefoxitin (46.5%), Ceftazidime (41%), Imipenem (32.5%), and varied degrees of resistance to other antibiotics was observed. Multidrug resistance (MDR) was observed in 30 (69.7%) of the P. aeruginosa isolates. Sivanmaliappan et al.24 reported that 55.5% of P. aeruginosa were multidrug resistant (MDR); 100% were resistant to ampicillin, 83.3% to piperacillin, and 66.6% to ceftazidime, gentamycin and imipenem. However, our results show that ceftazidime, imipenem, and piperacillin/tazobactam combination display higher activity as antipseudomonal agents. Banar et al.30 also stated that ceftazidime displayed high activity in P. aeruginosa isolates. In a study on DFI in Tanzania, resistance was noted for all commonly used antibiotics, except imipenem (100% sensitivity). This can be attributed to the fact that imipenem is expensive in low-resource countries.38 Previous reports described the increased efficacy of piperacillin-tazobactam against several virulence traits, such as adhesion, biofilm production, and flagellin production.39 The increased prevalence of MDR has been noted in different studies worldwide.30,31,40,41 This can be attributed to extensive use of antibiotics, which gives a selective advantage for survival of pathogenic bacterial strains. MDR P. aeruginosa guarded by biofilms that are difficult to penetrate can survive and develop more resistance.41,42

Biofilm production is the benchmark characteristic for the development of DFIs, and provides a balance between colonization and infection.25 Bacteria within biofilms produce their own matrix of extracellular polymeric substances (EPS). EPS contains glycoproteins and polysaccharides that provide protection against several environmental factors, mediate persistence in medical devices, facilitate immune system evasion, and contribute to the development of antimicrobial resistance.15,21,22 There are three major exopolysaccharides that significantly contribute to the formation and stabilization of the biofilm matrix of P. aeruginosa. The pentasaccharide Psl is essential to promote both cell-cell and cell-surface interactions, thereby initiating biofilm formation and providing structural support to the formed biofilm. The PslD protein is encoded by the pslD gene, a part of the psl operon. The PslD protein is located in the periplasm/outer membrane and contributes to the export of essential biofilm exopolysaccharides. Alginate is another important polymer that significantly stabilizes biofilm formation and provides additional protection. The synthesis of alginate protein is mediated by the algACD operon. The algD gene controls the synthesis of the alginate proteins. The algD gene controls the production of the final precursor, GDP-mannuronic acid, one of the two monomers of alginate. The pellicle operon controls the synthesis of the third major exopolysaccharide, the Pel protein, which is responsible for pellicle formation.30,31

In this context, biofilm formation was evaluated both phenotypically using the crystal violet assay, in addition to molecular detection of genes responsible for biofilm formation, algD, pslD, and pelf . Phenotypic characterization revealed that 93% (40) of the 43 P. aeruginosa isolates examined were biofilm producers; 53.4% (23) of P. aeruginosa isolates were strong biofilm producers, 23.3% (10) were moderate biofilm producers, 16.3% (7) were weak biofilm producers, and only 6.9% (3) were non-biofilm producers. Kamali et al. reported that 83.75 % of their P. aeruginosa isolates were biofilm producers with variable degrees of biofilm production.31 Banar et al.30 reported that out of 57 P. aeruginosa isolates tested 55 (96.5%) isolates were biofilm producers with variable degrees of biofilm production, and only 2 (3.5%) isolates were regarded as non-biofilm producers.

The frequency of genes encoding biofilm exopolysaccharides among the 43 P. aeruginosa isolates was as follows: algD (100%), pelF (88%) and pslD (49.7%). The present study showed a high prevalence of all three genes, algD, pslD, and pelf, in a considerable proportion of the P. aeruginosa isolates. Approximately 82.6 % of the 23 strong biofilm producers showed a algD +/pslD +/pelF + genotypic pattern, while 17.4 % showed algD −/pslD −/pelF −.

Banar et al.30 also reported similar frequencies of biofilm genes: pelF (93%), pslD (54.65%), and algD (100%), with algD +/pslD +/pelF + being the predominant genotypic pattern among their isolates. Another study by Kamali et al.31 reported that algD +/pslD +/pelF + genotypic pattern (87.5%) was the predominant pattern among their isolates. Pournajaf et al.43 reported that the frequency of pslD and pelF genes was 89.5% and 57.3%, respectively, in their isolates. Ghadaksaz et al.44 reported a frequency of 83.7% for pslD and 45.2% for pelF in their isolates. However, to the best of our knowledge, only a few studies have investigated the presence of biofilm-encoding genes, algD, pslD, and pelf.31

CONCLUSION

During the different waves of the COVID-19 pandemic, there has been an increased incidence of DM and DFIs. P. aeruginosa is the predominant etiological agent for DFIs. In the present study, the majority of P. aeruginosa isolates were MDR and biofilm producers. A high prevalence of biofilm-encoding genes were identified in this study, highlighting a need for inhibitors of biofilm formation to prevent the persistence of bacterial pathogens, and thereby achieve better clinical outcomes.

Declarations

ACKNOWLEDGMENTS
The authors thank Pharos University in Alexandria and Medical technology centre for their technical support.

CONFLICT OF INTEREST
The authors declare that there is no conflict of interest.

AUTHORS’ CONTRIBUTION
Both the authors listed have made a substantial, direct and intellectual contribution to the work, and approved it for publication.

FUNDING
None.

ETHICS STATEMENT
The study was approved by the Unit of Research Ethics Approval Committee [UREAC], Pharos University in Alexandria, Egypt.

AVAILABILITY OF DATA
All datasets generated or analyzed during this study are included in the manuscript.

References
  1. Rastogi A, Hiteshi P, Bhansali AA, Jude EB. Virtual triage and outcomes of diabetic foot complications during Covid-19 pandemic: A retro-prospective, observational cohort study. PLoS One. 2021;16(5):e0251143.
    Crossref
  2. Chaudhary S, Bhansali A, Rastogi A. Mortality in Asian Indians with Charcot’s neuroarthropathy: a nested cohort prospective study. Acta Diabetol. 2019;56(12):1259-1264.
    Crossref
  3. Rastogi A, Goyal G, Kesavan R, et al. Long term outcomes after incident diabetic foot ulcer: Multicenter large cohort prospective study (EDI-FOCUS investigators) epidemiology of diabetic foot complications study. Diabetes Res Clin Pract. 2020;162:108113.
    Crossref
  4. American Diabetes Association (ADA). 11. Microvascular Complications and Foot Care: Standards of Medical Care in Diabetes-2020. Diabetes Care. 2020;43(Suppl 1):S135-s151.
    Crossref
  5. Ugwueze CV, Ezeokpo BC, Nnolim BI, Agim EA, Anikpo NC, Onyekachi KE. COVID-19 and Diabetes Mellitus: The Link and Clinical Implications. Dubai Diabetes Endocrinol J. 2020;26(2):69-77.
    Crossref
  6. Huang C, Wang Y, Li X, et al. Clinical features of patients infected with 2019 novel coronavirus in Wuhan, China. Lancet. 2020;395(10223):497-506.
    Crossref
  7. Li XC, Zhang J, Zhuo JL. The vasoprotective axes of the renin-angiotensin system: Physiological relevance and therapeutic implications in cardiovascular, hypertensive and kidney diseases. Pharmacol Res. 2017;125(Pt A):21-38.
    Crossref
  8. European Societies of Cardiology Position statement of ESC Council on Hypertension on ACE-inhibitors and angiotensin receptor blockers. March 13, 2020 [Online] Available from: https//:www.escardio.org/Councils/Council-on−hypertension-(CHT)/News/Position statement-of the esc-council-on hypertension-on- ace inhibitors and angiotensin receptor blockers. Accessed 2020 May 16.
  9. Liu C, Li Y, Guan T, et al. ACE2 polymorphisms associated with cardiovascular risk in Uygurs with type 2 diabetes mellitus. Cardiovasc Diabetol. 2018;17(1):127.
    Crossref
  10. Yang JK, Feng Y, Yuan MY, et al. Plasma glucose levels and diabetes are independent predictors for mortality and morbidity in patients with SARS. Diabet Med. 2006;23(6):623-628.
    Crossref
  11. Muniyappa R, Gubbi S. COVID-19 pandemic, coronaviruses, and diabetes mellitus. Am J Physiol Endocrinol Metab. 2020;318(5):E736-e741.
    Crossref
  12. Riddle MC, Buse JB, Franks PW, et al. COVID-19 in People With Diabetes: Urgently Needed Lessons From Early Reports. Diabetes Care. 2020;43(7):1378-1381.
    Crossref
  13. Boulton AJM. Diabetic Foot Disease during the COVID-19 Pandemic. Medicina (Kaunas). 2021;57(2):97.
    Crossref
  14. Adeleye OO, Ugwu ET, Gezawa ID, Okpe I, Ezeani I, Enamino M. Predictors of intra-hospital mortality in patients with diabetic foot ulcers in Nigeria: data from the MEDFUN study. BMC Endocr Disord. 2020;20(1):134.
    Crossref
  15. Mutonga DM, Mureithi MW, Ngugi NN, Otieno FCF. Bacterial isolation and antibiotic susceptibility from diabetic foot ulcers in Kenya using microbiological tests and comparison with RT-PCR in detection of S. aureus and MRSA. BMC Res Notes. 2019;12(1):244.
    Crossref
  16. Mendes J, Neves J. Diabetic foot infections: current diagnosis and treatment. J Diabet Foot Complicat. 2012:4(2):26-45.
  17. Uckay I, Gariani K, Pataky Z, Lipsky BA. Diabetic foot infections: state-of-the-art. Diabetes Obes Metab. 2014;16(4):305-316.
    Crossref
  18. Lipsky BA, Richard JL, Lavigne JP. Diabetic foot ulcer microbiome: one small step for molecular microbiology. One giant leap for understanding diabetic foot ulcers? Diabetes. 2013;62(3):679-681.
    Crossref
  19. Stappers MHT, Hagen F, Reimnitz P, Mouton JW, Meis JF, gyssens IC. Direct molecular versus culture-based assessment of Gram-positive cocci in biopsies of patients with major abscesses and diabetic foot infections. Eur J Clin Microbiol Infect Dis. 2015;34(9):1885-1892.
    Crossref
  20. Messad N, Prajsnar TK, Lina G, et al. Existence of a Colonizing Staphylococcus aureus Strain Isolated in Diabetic Foot Ulcers. Diabetes. 2015;64(8):2991-2995.
    Crossref
  21. Spichler A, Hurwitz BL, Armstrong DG, Lipsky BA. Microbiology of diabetic foot infections: from Louis Pasteur to ‘crime scene investigation’. BMC Med. 2015;13(1):2.
    Crossref
  22. Banu A, Noorul Hassan MM, Rajkumar J, Srinivasa S. Spectrum of bacteria associated with diabetic foot ulcer and biofilm formation: A prospective study. Australas Med J. 2015;8(9):280-285.
    Crossref
  23. Shahi SK, Kumar A. Isolation and Genetic Analysis of Multidrug Resistant Bacteria from Diabetic Foot Ulcers. Front Microbiol. 2015;6:1464.
    Crossref
  24. Sivanmaliappan TS, Sevanan M. Antimicrobial Susceptibility Patterns of Pseudomonas aeruginosa from Diabetes Patients with Foot Ulcers. Int J Microbiol. 2011;2011:605195.
    Crossref
  25. Pouget C, Dunyach-Remy C, Pantel A, Schuldiner S, Sotto A, Lavigne J-P. Biofilms in Diabetic Foot Ulcers: Significance and Clinical Relevance. Microorganisms. 2020;8(10):1580.
    Crossref
  26. Clinical and laboratory standards institute (CLSI). Performance standards for antimicrobial susceptibility testing: CLSI Supplement M100. 29th Ed. CLSI, Wayne, PA, 2019.
  27. Alcaraz E, Garcia C, Papalia M, Vay C, Friedman L, de Rossi BP. Stenotrophomonas maltophilia isolated from patients exposed to invasive devices in a university hospital in Argentina: molecular typing, susceptibility and detection of potential virulence factors. J Med Microbiol. 2018;67(7):992-1002.
    Crossref
  28. Stepanovic S, Vukovic D, Hola V, et al. Quantification of biofilm in microtiter plates: overview of testing conditions and practical recommendations for assessment of biofilm production by staphylococci. Apmis. 2007;115(8):891-899.
    Crossref
  29. Sambrook J, Russell D. Molecular Cloning: Laboratory Manual. Cold Spring Harbor Laboratory Press, New York. 2001.
  30. Banar M, Emaneini M, Satarzadeh M, et al. Evaluation of Mannosidase and Trypsin Enzymes Effects on Biofilm Production of Pseudomonas aeruginosa Isolated from Burn Wound Infections. PLoS One. 2016;11(10):e0164622.
    Crossref
  31. Kamali E, Jamali A, Ardebili A, Ezadi F, Mohebbi A. Evaluation of antimicrobial resistance, biofilm forming potential, and the presence of biofilm-related genes among clinical isolates of Pseudomonas aeruginosa. BMC Res Notes. 2020;13(1):27.
    Crossref
  32. Jarl G, Alnemo J, Tranberg R, Lundqvist L-O. Gender differences in attitudes and attributes of people using therapeutic shoes for diabetic foot complications. J Foot Ankle Res. 2019;12:21.
    Crossref
  33. Dinh T, Veves A. The influence of gender as a risk factor in diabetic foot ulceration. Wounds. 2008;20(5):127-131.
  34. Hitam SAS, Hassan SA, Maning N. The Significant Association between Polymicrobial Diabetic Foot Infection and Its Severity and Outcomes. Malays J Med Sci. 2019;26(1):107-114.
    Crossref
  35. Hatipoglu M, Mutluoglu M, Uzun G, Karabacak E, Turhan V, Lipsky BA. The microbiologic profile of diabetic foot infections in Turkey: a 20-year systematic review: diabetic foot infections in Turkey. Eur J Clin Microbiol Infect Dis. 2014;33(6):871-878.
    Crossref
  36. Hobizal KB, Wukich DK. Diabetic foot infections: current concept review. Diabet Foot Ankle. 2012;3:18409.
    Crossref
  37. Ramakant P, Verma AK, Misra R, et al. Changing microbiological profile of pathogenic bacteria in diabetic foot infections: time for a rethink on which empirical therapy to choose? Diabetologia. 2011;54(1):58-64.
    Crossref
  38. Chalya PL, Mabula JB, Dass RM, et al. Surgical management of Diabetic foot ulcers: A Tanzanian university teaching hospital experience. BMC Res Notes. 2011;4:365.
    Crossref
  39. Zhang J, Chu Y, Wang P, et al. Clinical outcomes of multidrug resistant pseudomonas aeruginosa infection and the relationship with type III secretion system in patients with diabetic foot. Int J Low Extrem Wounds. 2014;13(3):205-210.
    Crossref
  40. Srivastava P, Sivashanmugam K. Combinatorial Drug Therapy for Controlling Pseudomonas aeruginosa and Its Association With Chronic Condition of Diabetic Foot Ulcer. Int J Low Extrem Wounds. 2020;19(1):7-20.
    Crossref
  41. Zubair M, Malik A, Ahmad J. Clinico-microbiological study and antimicrobial drug resistance profile of diabetic foot infections in North India. Foot (Edinb). 2011;21(1):6-14.
    Crossref
  42. Matta-Gutiérrez G, García-Morales E, García-Álvarez Y, Álvaro-Afonso FJ, Molines-Barroso RJ, Lázaro-Martínez JL. The Influence of Multidrug-Resistant Bacteria on Clinical Outcomes of Diabetic Foot Ulcers: A Systematic Review. J Clin Med. 2021;10(9):1948.
    Crossref
  43. Pournajaf A, Razavi S, Irajian G, et al. Integron types, antimicrobial resistance genes, virulence gene profile, alginate production and biofilm formation in Iranian cystic fibrosis Pseudomonas aeruginosa isolates. Infez Med. 2018;26(3):226-236. PMID: 30246765
  44. Ghadaksaz A, Fooladi IAA, Mahmoodzadeh Hosseini H, Amin M. The prevalence of some Pseudomonas virulence genes related to biofilm formation and alginate production among clinical isolates. J Appl Biomed. 2015;13(1):61-68.
    Crossref

Article Metrics

Article View: 7047

Share This Article

© The Author(s) 2022. Open Access. This article is distributed under the terms of the Creative Commons Attribution 4.0 International License which permits unrestricted use, sharing, distribution, and reproduction in any medium, provided you give appropriate credit to the original author(s) and the source, provide a link to the Creative Commons license, and indicate if changes were made.