Isolation of keratinolytic bacteria with chicken feathers
Isolation and screening of the keratolytic bacteria were performed by suspending the samples in feather meal broth medium as described by Agrahari and Wadhwa²⁰. One gram of the soil sample and poultry or feather waste was added in 50 ml of the medium. All flasks were incubated at 37°C for 7-14 days. Then, 1 ml broth of each was transferred to Feather Meal Agar Medium plates and incubated at 37°C for 2 days. The developed colonies were purified by repeated streaking to obtain pure culture on Nutrient agar plates.

Chicken feathers were used as a substrate to isolate keratinolytic bacteria in keratin medium. Chicken feathers were obtained from the Al-Rayan poultry farm, Jeddah, Saudi Arabia. Feathers were prepared according to Tork et al., 2010²¹ with minor modification. Feather-degrading bacteria were isolated and grown in feather meal medium (basic medium) containing (g LG1): K₂HPO₄ (1.4), MgSO₄ (0.1), KH₂PO₄ (0.7), NaCl (0.5), ground keratin as sole carbon and nitrogen source, and 15-20 g agar for solidification. The pH of this medium was adjusted to 7.0 ^9,22. The feather meal plates were spread with 1mL diluted medium and incubated at 37°C for 2 days for general bacteria whereas incubation of 5-7 days was carried out for actinomycetes. Nutrient agar medium was used to maintain purified bacterial colonies at 4°C.

Screening of keratolytic bacteria
Primary screening of keratolytic bacteria
Keratolytic bacteria were primarily screened with skimmed milk agar medium¹⁹. All the ingredients of the milk agar medium were sterilized in autoclave except milk powder. The sterile milk powder was separately added as the medium reached the tolerable temperature (45ºC). The sterilized medium was poured into sterile Petri dishes. The suspected bacteria isolates, maintained in starch agar medium and nutrient agar, were inoculated in milk agar plates. The plates were incubated at 37°C for two days and examined for the formation of clear zones on the skimmed milk agar. The bacterial isolates exhibiting clear zone formation on the agar medium were recorded as positive.

Secondary screening of keratolytic bacteria
The positive isolates of primary screening were subjected to secondary screening for the isolation of feather degrading bacteria. A modified basal liquid medium supplemented with a native chicken feather (5 cm) was placed in test tubes for secondary screening. The medium was sterilized and inoculated with selected bacterial isolates of primary screening. The test tubes were incubated at 37°C and examined on weekly basis for feather degradation.

Identification of Bacterial Isolate BAM3
The best keratinase-producing microorganism was identified based on cultural, morphological, and biochemical tests such as oxidase and catalase production assays. Molecular identification of the most promising isolate (BAM3) revealed it as keratinolytic Bacillus sp. BAM3. Molecular identification was carried out by extracting genomic DNA of bacteria grown to exponential phase in Luria-Bertani medium. Centrifugation of bacterial culture was carried out for 15 min at 12,000 rpm and supernatant (10 ml aliquot) was harvested. Sterile distilled water was used to wash the supernatant. Gene JET Genomic DNA Purification kit (Thermo Fisher Scientific, Massachusetts, USA) was used to extract the DNA. PCR amplification of 16SrDNA was carried out with two primers (16F27: 52  AGAGTTTGATCCTGGCTCAG 32  and 16R1522: 52  AAGGAGGTGATCCAGCCGCA 32 )  according to Buonaurio et al.²³. A reaction mixture of 25 µL was prepared for the PCR amplification of the 16S rRNA gene.  The reaction mixture contained 12.5 µL master mix (2x), 1 µL of each primer (10 pmoles/µl), 2 µL DNA, and 9.5 µL dH2O. PCR conditions were set as initial denaturation at 94 ^oC for 5 min, 35 denaturation cycles at 94 ^oC for 1 min, annealing at 55 ^oC for 1 min, extension at 72 ^oC for 2 min, and a final extension at 72 ^oC for 10 min. Sanger sequencing of PCR samples was carried out from Beijing Genomic Institute (BGI), Hong Kong, China. BLAST software of the NCBI database was used to compare the sequences. T-Caffee algorithm (https://www.ebi.ac.uk/, EMBL-EBI, Cambridgeshire, UK) was used to align the obtained sequences in Ugene ²⁴. The phylogenetic tree was constructed in an interactive tree tool iTOL (http://itol.embl.de/index. shtml) ²⁴.

Keratinase Assay
The method of Letourneau et al. ²⁶ was followed to estimate Keratinase activity by using Keratin azure substrate (Sigma-Aldrich, USA). The substrate was frozen at -10°C followed by grinding into fine powder in Oscillating mil mm400 retch.  Five-gram fine powder of the substrate was suspended in 1 ml of 50 mM Tris-HCl buffer (pH 8.0). The reaction mixture containing 1 ml of each, crude enzyme and keratin azure suspension, was placed in a water bath at 50°C for 30 min. 2 ml of 0.4 M trichloroacetic acid (TCA) was finally added to stop the reaction. The substrate was removed by centrifuging the mixture for 5 min at 3000×g. Spectrophotometry of the supernatant was carried out at 595 nm to measure the release of azo dye. The amount of enzyme causing 0.01 absorbance increase between the sample and control at 595 nm was considered as one-unit (U) of keratinase activity^23,25.

Effect of pH and temperature on keratinase production
The flasks were incubated at different temperatures (25, 30, 37, 45, and 50°C) for 7 days at 200 rpm to assess optimum temperature. Keratin azure was used as a substrate at optimum growth temperature, and bacterial growth and keratinase activity were measured. The effect of different pH on keratinase production of the selected bacterial isolate was also estimated. The medium was prepared at pH 5, 6, 7, 8, and 9. Different sterile feather meal broths were separately placed in 250 ml Erlenmeyer flasks containing 50 ml of the medium and 2 ml of pre-culture of the selected bacterial culture. The flasks were incubated at 37ºC for 7 days at 200 rpm and bacterial growth and keratinase activity were evaluated.

Preparation of bioplastic film
The keratin-based bioplastic was prepared according to Ramakrishnan et al²⁷ with slight modifications. Keratin solution (100 ml) was mixed with different concentrations of glycerol (2, 5, and 10 wt%) and subjected to constant magnetic stirring for 5 h at 60 °C. The aliquot was spread on circular aluminum weighing boat (43 mm diameter at top) and placed in the oven for 24 h at 60 °C. After 24 h, the mixture was allowed to cool down and dry. Then, bioplastic film was detached from the aluminum weighing boat and labeled. The process was repeated for all glycerol concentrations.

Statistical Analysis
The experiments were performed in triplicate. Means of replicates and standard deviation were compared by student t-test to differentiate between controls and treatments.