Open Access

Methak Jasim AL-Jboory  

University Musstansiryah, College of Sciences, Iraq.
J Pure Appl Microbiol. 2018;12(1):177-179
https://doi.org/10.22207/JPAM.12.1.22 | © The Author(s). 2018
Received: 26/01/2018 | Accepted: 10/03/2018 | Published: 31/03/2018
Abstract

The present study was carried out to detect the association of microRNA-146a haplotypes polymorphisms with Systemic lupus erythematous (SLE) in Iraqi patients, PCR-SSCP technique used in present study, blood was used to DNA extraction, the results show that there was strong association between microRNA-146a and SLE in one haplotype from two. The present study concluded that there was association between microRNA-146a polymorphisms with SLE, our finding need more investigation to use this polymorphism as early indication of SLE incidence.

Keywords

Lupus, MicroRNA, miR-146a, PCR-SSCP technique, Haplotypes, Polymorphisms.

Introduction

Systemic lupus erythematous is autoimmune disease lead to tissue damage due to inflammation ( Lourenço. and La Cava ,2009).This disease begin with minimal or no activity and gradually increased its activity  and its symptoms include skin rashes, arthralgia, and fatigue (Davies et al.,2012). It is more prevalent in female than in male with estimated ratio 9:1 ( Petri et al.,2012). The factors that contribute in the etiology of the disease are environmental factors and genetic  susceptibility. Viral infection or administration of certain drugs together with genetic factors can lead to promote SLE disease development ( Ceccarelli et al.,2015)   .

MicroRNAs are regulatory genes which have crucial role in regulation of the response of the innate and adaptive immunity by the post-transcriptional regulation of most genes regulatory pathways and this may lead to development of systemic autoimmunity including lupus , one of these microRNAs is miR-146a .( Liang and Shen, 2012).

Materials and Methods
  1. Sample and data collection; about 2 ml of whole blood was collected from patients of Systemic lupus erythematous in Marjan hospital .All subjects in this study were taken written consent before participation in this study according to ethical approval of Iraq ministry of health, while control collected from healthy, the clinical features of disease were diagnostic by specialist prof Dr Ali al- kazaz also all data were collected for other genetic detection in this disease .
  2. DNA extraction; DNA was extracted from whole blood using Favor gene extraction kit and concentration and purity were detected using nanodrope ( Al-Terehi et al.,2016a).
  3. MiR-146a primer was (5’-GGGTCTTTGCACCATCTCTG-3’ for the upstream primer and 5’- TCCAGTCTTCCAAGCTCTTCA -3’ for downstream. (Vinci et al., 2013).
  4. PCR conditions and size products MiR-146a denaturation for 5 min at  94°C, then 30 cycles (30 s at 94°C, 20 s at 57.8°C, 50 s at 72°C, and finally 10 min at 72°C). PCR products were determined by electrophoresis pattern in agarose gel (1.5% agarose, 70 V, 20 mA for 45 min) with ethidium bromide staining, the PCR size product were (195) bp for MiR-146a .Statics, the results were statically analysis using odd ratio at CI 95% nd p value <0.05).
  5. SSCP technique, PCR products were denaturation using SSCP dye (EDTA, formamid and bromophynol blue) 1/1 V:V in water bath for 5 min at 95°C then its child in ice for 2 min.
  6. SSCP electrophoresis, the products were electrophoresis as a following About 10 µl of the samples (sample+ dye) were loaded into wells of 8% acrylamide/bis gel containing 7% glycerol, and 1X TBE buffer. In more details; for recipe a 20 × 20 0.1 cm gel format. 8 ml of 40% acrylamide/bis (stoke solution 37.5:1) mixed with 8 ml of 5X TBE, 2.8 ml,100% glycerol, then 40 µl TEMED and 400 µl of 10% ammonium per sulfate were added with 20.8 ml of dH2O After gel was casting sample were loaded and Run under the following conditions. Buffer 5.5 X TBE, Buffer temperature 10°C, Run time 1.5 h and 100V. Then gel was staining using ethedium bromide for 15 min.
  7. Haplotype frequency were determination by variety of bands pattern between patients and control (Al-Terehi et al., 2016).
  8. The statics analysis implemented using Qi square and odd ration at p value <0.05.
RESULTS AND DISCUSSION

The results of study show DNA extraction from whole blood (figure 1)

Fig. 1. Electrophoresis pattern of gnomic DNA in study groups, lane 1-5 DNA from patients lane 6-10 DNA from control

The results of miR-146a of gene polymorphism which show in Table 1 and Figure 2 clarified the variation of haplotypes in patients and control, there were 2 pattern (A and B), polymorphisms show significant differences(p>0.05) between patients and control where haplotype A was appeared in control with (75%) while in patients it was absent, and haplotype B was appeared in control with (25%) while in patients it was (100%). Systemic lupus erythematous is autoimmune disease which cause inflammation throughout the body and this lead to trigger the innate and adaptive immune response. The study of (Boldin et al.,2011) found that mice suffering from severe lupus-like autoimmune disorder characterized by multi-organ inflammation ,lymphadenopathy, splenomegaly, , and greatly increased autoantibody production when they have deficient of miR-146a  .MicroRNAs genes are regulatory genes which have important role in regulation and maintenance of the immune system response.MiR-146a participate in the regulation of T-cell lineage. Several studies indicated that miR-146a  act on the decrease the function of interferon and toll like receptor(TLR) signaling by repressing the target genes of  TLR and interferon such as (Traf6/Irak1Stat1 and Tlr7 or Tlr9 ) and thus miR-146a play important role in the pathogenesis of lupus (Chan et al.,2013 ; So et al.,2013) .


Fig. 2. Electrophoresis pattern of PCR-SSCP of miR-146a gene polymorphism for patients 1, and control 2

Table (1):
Haplotypes frequency of miR-146a gene in patients and control.

P value
95 % CI
Odd ratio
patient
Control
pattern
0.0001 to 0.0280
0.0017
0%
75%
3 bandsA
35.6584 to 9932.1679
595.1176
100%
25%
2 bandsB

The study of (Luo et al.,2011) investigated that the genetic variant(rs57095329) in the promoter region of miR-146a in SLE patients are reduced  where the risk allele G in this variant had contributing in the decrease binding to transcription factor Ets-1, and lead to reduce the levels of miR-146a in SLE patients. The meta-analysis in other study found that the SNPs (  rs57095329 and rs2431697) of miR-146a are associated strongly with SLE susceptibility  ( Ji et al.,2014). Our finding need more investigation to detect the mutations in microRNAs that may be related with the etiology of SLE.

CONCLUSION

The present study concluded that there were one haplotype in miR-146a is associated strongly with SLE in Iraqi patients.

References
  1. Petri M, Orbai A, Alarcón GS, et al. Derivation and validation of the Systemic Lupus International Collaborating Clinics classification criteria for systemic lupus erythematosus. Arthritis Rheum. 2012; 64:2677-2686.
  2. Ceccarelli F, Perricone C, Borgiani P, et al. Genetic factors in systemic lupus erythematosus: contribution to disease phenotype. J Immunol Res. 2015; 2015:745647.
  3. Davies RJ, Lomer MCE, Yeo SI, et al. Weight loss and improvements in fatigue in systemic lupus erythematosus: a controlled trial of a low glycaemic index diet versus a calorie restricted diet in patients treated with corticosteroids. Lupus. 2012; 21:649-655
  4. Lourenço E.V. and La Cava*,A.(2009). Cytokines in Systemic Lupus Erythematosus. Curr Mol Med. 2009; 9(3): 242–254.
  5. Liang D, Shen N. MicroRNA involvement in lupus: the beginning of a new tale. Curr Opin Rheumatol. 2012; 24:489–498
  6. Vinci, S.; Gelmini, S.; Mancini, I. ; Malentacchi, F.; Pazzagli, M.; Beltrami, C.; Pinzani, P.; Orlando, C. Genetic and epigenetic factors in regulation of microRNA in colorectal cancers,. Methods, 2013; 59: 138–146
  7. Boldin MP, Taganov KD, Rao DS, Yang L, Zhao JL, Kalwani M, Garcia-Flores Y, Luong M, Devrekanli A, Xu J, Sun G, Tay J, Linsley PS, Baltimore D. miR-146a is a significant brake on autoimmunity, myeloproliferation, and cancer in mice. J Exp Med. 2011; 208:1189–1201.
  8. Chan EK, Ceribelli A, Satoh M. MicroRNA-146a in autoimmunity and innate immune responses. Ann Rheum Dis. 2013; 72(Suppl 2):ii90–ii95.
  9. So AY, Zhao JL, Baltimore D. The Yin and Yang of microRNAs: leukemia and immunity. Immunol Rev. 2013; 253:129–145.
  10. Ji JD1, Cha ES2, Lee WJ2.(2014). Association of miR-146a polymorphisms with systemic lupus erythematosus: a meta-analysis. Lupus.; 23(10):1023-30.
  11. Al-Terehi M., Hasan A., AL-Jboory J M. Al-Saadi1 A., Zaidan H., obiad S. Haplotype Polymorphisms in Cytokines Genes Using Pcr-Sscp Technique in Iraqi Breast Cancer Patients Der Pharma Chemica, 2016, 8(22):27-31
  12. Luo, X, Yang, W, Ye, DQ. A functional variant in microRNA-146a promoter modulates its expression and confers disease risk for systemic lupus erythematous. PLoS Genet 2011; 7: e1002128–e1002128
  13. Al-Terehi M., Ghaleb R, Al-Oubaidy SH., Al-Saadi A.,. Zaidan H. (2016 a) Study TNF-á gene polymorphism in Type 1 Diabetic Patients  Using  ARMS  technique Journal of Chemical and Pharmaceutical Science CPS, 9(3): 1107-1111.

Article Metrics

Article View: 7449

Share This Article

© The Author(s) 2018. Open Access. This article is distributed under the terms of the Creative Commons Attribution 4.0 International License which permits unrestricted use, sharing, distribution, and reproduction in any medium, provided you give appropriate credit to the original author(s) and the source, provide a link to the Creative Commons license, and indicate if changes were made.