Open Access
Masoumeh Navidinia1 , Mehdi Goudarzi2, Samira Molaei Rameshe3, Zahra Farajollahi3, Pedram Ebadi Asl3, Saeed Zaka khosravi3 and Mohammad Reza Mounesi3
1School of Allied Medical Sciences, Shahid Beheshti University of Medical Sciences, Tehran, IR Iran.
2Faculty of Medical Sciences, Shahid Beheshti University of Medical Sciences, Tehran, IR Iran.
3Student’s Research Committee, School of Allied Medical Sciences, Shahid Beheshti University of Medical Sciences, Tehran, IR Iran.
J Pure Appl Microbiol. 2017;11(2):779-792
https://doi.org/10.22207/JPAM.11.2.17 | © The Author(s). 2017
Received: 01/05/2017 | Accepted: 03/06/2017 | Published: 30/06/2017
Abstract

In the last decade, along with the problem of nosocomial infections, multidrug-resistant bacteria in community and hospitals have soared. High frequencies of multidrug-resistant bacteria have been grouped under the acronym ESKAPE which capable of ‘escaping’ the biocidal action of antimicrobial agents. The objective of this study is to consider molecular characterization of resistance genes in ESKAPE pathogens. In this study, three hundred and eighty four bacteria were isolated from clinical samples in Loghman-Hakim Hospital, Tehran, Iran. MDR strains reported through disk diffusion method based on CLSI guidline. Molecular characterization of resistance genes were examined by PCR method. The prevalence of MDR-strains of Enterococcus faecium, Staphylococcus aureus, Klebsiella pneumoniae, Acinetobacter baumannii, Pseudomonas aeruginosa, Enterobacter spp. were 3(9.09%), 17(23.3%), 11(11.22%), 18(18.36%), 9(18.91%), 4(5.8%), respectively. The most prevalence of resistant genes in ESKAPE bacteria were following as:vanA 40.90%,vanB 22.72% in Enterococcus faecium;mecA24.65%,vanA4.11%, vanB1.37%in Staphylococcus aureus;bla TEM 28.57,blaKPC 12.24% in Klebsiella pneumonia;blaSHV 56.75%,blaVIM 32.43%,bla TEM 29.73 %in Acinetobacter baumannii; blaSHV 44.70%,bla OXA 55.29%,blaVEB 74.11%,blaVIM 62.35%,blaPER 62.35%,Mex-A 74.11% ,Mex-B 81.17%, Mex-R76.47% , blaPER 62.35% in Pseudomonas aeruginosa; bla TEM 39.13%, blaSHV 33.33% in Enterobacter spp. Knowledge of resistance genes prevalence in ESKAPE pathogens is necessary to prepare feasible data about tracing and treatment of infection related to these microorganisms that may be beneficial to clinicians to select a convenient empirical therapeutic diet in diseases due to ESKAPE pathogens at the bedhead. It is recommended that healthcare-associated, community-acquired, and nosocomial infections to be clearly considered annually.

Keywords

Molecular characterization, Resistance genes, ESKAPE pathogens.

Introduction

Importance of ESKAPE in clinics
The ESKAPE pathogens able to get away from antibiotics biocidal action and generally show new example in pathogenesis, transmission trace and resistance pattern. The ESKAPE group contains Enterococcus faecium, Staphylococcus aureus, Klebsiella pneumonia, Acinetobacter baumannii, Pseudomonas aeruginosa, Enterobacter spp.1

Recently, understanding of virulence, resistance, transmission and pathogenicity of these microbes cause to innovative strategies for the progress of new antimicrobial options. Directing attention towards ESKAPE will help to concentrate antimicrobial resistance (AMR) challenge and allow efficient critical assessment of new antimicrobial drugs. Unfortunately, increasing resistance to treatment in ESKAPE has been recognized in recent years2

Enterococcus faecium (E)
One of the parts of normal intestinal flora of most humans is Enterococcus genus3, 4 The two most significant species, Enterococcus faecalis and Enterococcus faecium, cause various human infections such as septicemia, bacteremia, urinary tract infections (UTI), endocarditis, neonatal sepsis meningitis, and wound infections5, 6 Some resistant species e.g. High-level aminoglycoside-resistant (HLAR) enterococci and vancomycin-resistant enterococci (VRE) have been emerged and cause great difficulties in treatment7-9 There are nine vancomycin resistance genes contain van A, B, C, D, E, G, L, M, and N. The most predominant types in worldwide are vanA and vanB10-12. Gene vanA, relates to a high degree resistance to teicoplanin and vancomycin, is mostly conferred to vancomycin resistant Enterococcus faecium13. Gene vanB relates to a vancomycin high level resistant but susceptibility to other glycopeptides such as teicoplanin whereas previous antibiotics able to induce the vanB resistance type14.

Staphylococcus aureus (S)
A common agent of the skin microbiota and generally is isolated from moist anatomical areas is S. aureus. Nearly 60% of the human population harbor S. aureus irregularly as intermittent carriers; whereas around 20% of individuals almost always carry a single S. aureus strain as persistent carriers. Even, S. aureus is a common wound pathogen, cause both acute and chronic infections by biofilm formation.

After the first clinical reports of methicillin resistance S. aureus (MRSA) in 1960s, via mecA expression which encodes a low affinity penicillin-binding protein (PBP2a), MRSA has expended resistance against b-lactam antibiotics including all b-lactams such as penicillins, cephalosporins, and carbapenems. First-line drug of choice for infections due to MRSA is mostly glycopeptide antibiotics such as vancomycin or teicoplanin. Unfortunately, being intensive selective pressure has caused to emerge vancomycin-intermediate S. aureus (VISA), and vancomycin-resistant S. aureus (VRSA)2

Klebsiella pneumonia (K)
Being common isolated strain in health care setting, emergence of MDR K. pneumoniae and spread easily makes this microorganism as a main nosocomial pathogen to cause infections such as bacteremia, septicemia and urinary tract infections (UTIs) in children. Typically, MDR K. pneumoniae have been resistant to several different classes of antibiotics such as aminoglycosides, quinolones, β-lactams, and b-lactamase inhibitors. With the passage of time by means of the generation of their new mutant strains, resistant to antimicrobials drugs in MDR K. pneumoniae will become more and more15

As a results, carbapenem-resistant Enterobacteriaceae especially carbapenem-resistant K. pneumoniae (CRKP), are increasingly implicated in sporadic worldwide outbreaks due to multiple combinations of extended-spectrum β-lactamases (ESBLs) and carbapenemases by means of the dissemination of mobile genetic platforms related to encoding every class of β-lactamase.(2)

Acinetobacter baumannii (A)
A great challenge for physicians and clinical microbiologists is management of MDR Acinetobacter spp. infections. Capability to survive in a health care setting makes it a common agent for healthcare-associated infections and lead to multiple outbreaks. (16-18) spectrums of infections due to MDR Acinetobacter spp. contain bacteremia, meningitis, pneumonia, UTI, and wound infection19-24

A. baumannii is intrinsically resistant to antibiotics constitutively due to express active efflux pump systems, the low-quantity expression of small-aperture outer membrane porins; possess a resistance island, which includes a cluster of genes encoding antibiotic and heavy metal resistance which impart resistance to ammonium-based disinfectants. The broad acquisition of ESBLs in some isolates confers with resistance to all known antimicrobials, containing imipenem and colistin. This combination of intrinsic virulence and multiple resistance factors, makes A. baumannii as symbol the superbug. So current clinical demand for novel antimicrobials is necessary25, 26

Pseudomonas aeruginosa (P)
There are some differences in the medical society to the definition of MDR, so the real incidence of MDR P. aeruginosa is not well proved27 Most of the time, MDR was described as resistance to at least three antimicrobial drugs from a different classes of antibiotics, mostly penicillins, cephalosporins, aminoglycosides, carbapenems, antipseudomonal, and fluoroquinolones. Annually, different geographic places and centers limit the ability to determine the right percentage of MDR P. aeruginosa spread28,29 Current articles have emphasized that above mentioned agents may or may not be as impressive as first-line drugs, but may as well as be pertaining to more considerable adverse effects (i.e. ototoxicity, nephrotoxicity, and neurotoxicity)30-38

Antibiotic therapy may induce expression or select for stably depressed mutants, resulting in resistance to ticarcillin, piperacillin and third-generation cephalosporins. Most common resistant mechanisms are usually due to the metallo-β-lactamases or MBLs (such as IMP, VIM, SPM and GIM), combination of low outer membrane permeability and multidrug efflux systems, overexpression of nodulation-cell division (RND) family of transporters (e.g., MexAB-OprM, MexCD-OprJ, MexEF-OprN and MexXY-OprM), detriment of the outer membrane protein (porin) OprD, and other mechanisms such as enzyme production and target mutations. Expression of acetyltransferases, nucleotidyl transferases and phosphotransferases (enzymes related to aminoglycoside-modifying and aminoglycoside resistance), are common too38-65.

Enterobacter Species (E)
Enterobacter spp., most commonly cause the urinary and respiratory tracts, bloodstream and serious nosocomial infections, displaying broad MDR via plasmid-encoded ESBLs and carbapenemases, such as KPC, verona integron-encoded metallo-b-lactamase, OXA and even metallo-²-lactamase-66,67. In addition to colistin and tigecycline, few antimicrobials drugs are effective against these resistant organisms .There are little or no drugs in the ‘pipeline’ that are known to be capable of effectively addressing this mounting health crisis2, 68

In veterinary medicine, fluoroquinolone resistance is become to increase. This resistance is occurred by both chromosomal and plasmid-mediated fluoroquinolone resistance (PMQR) mechanisms which accompany with other antimicrobial resistance genes containing β-lactamases. The genes’ relationship with PMQR can cause resistance to fluoroquinolone when joined with topoisomerase mutations and efflux pumps69, 70

So surveillance studies about ESKAPE can help governments to provide a public health plan to decrease use of improper antibiotics in infections caused by ESKAPE. In the last decade, along with the problem associated with nosocomial infections, MDR bacteria in community and hospitals have exceed. The objective of this study is to molecular approaches to resistance genes in ESKAPE pathogens.

Materials and Methods

Sample collection
In this descriptive study, 384 bacteria were isolated from clinical samples (such as trachea, urine, wound, discharges, ascites fluid, pleural fluid, blood, synovial fluid, and catheter) in Loghman-Hakim Hospital, Tehran, Iran.

Identification ESKAPE pathogens
Laboratory identification of Enterococci faecium was done by Gram staining, growth on blood agar, hydrolysis of esculin with blackening of bile esculin agar, negative catalase production, and growth on 6.5% sodium chloride71-73

The isolates were identified as Staphylococcus aureus based on morphologic and biochemical tests such as: Gram stain, catalase, coagulase, hot-cold ²-hemolysin on blood agar, DNAase and mannitol salt agar fermentation74 All the strains were screened for methicillin resistance by means of  oxacillin (1 µg) and cefoxitin (30 µg)  examination by disk diffusion test method, based on the standard guidelines75

For identification of Klebsiella pneumonia and Enterobacter spp., the samples were cultured on nutrient agar, MacConkey agar, blood agar and eosin methylene blue (EMB) agar (All of media were purchased from Hi Media Company, India). After incubation of plates at 35°C for 24 h, the pure isolates identified based on Gram stain and biochemical tests such as; catalase, oxidase, indole production, citrate utilization, sugar metabolism reaction on triple sugar iron agar, urea test, orthonitrophenyl-²-galactoside (ONPG) test, and methyl red Voges-Proskauer(MRVP), as described in standard bacteriological methods. All of the above chemicals and media were purchased from Sigma-Aldrich, Germany76, 77

For identification of Acinetobacter baumannii, we used standard bacteriologic and biochemical methods, which contained Gram staining, catalase tests, oxidase tests, motility, oxidation/fermentation (O/F) tests, citrate utilization tests, and capability to grow at 37 and 44oC78

Pseudomonas aeruginosa is a non-fermenting Gram negative rod which often related to human infection. It is a strict aerobe with a growth temperature range of 5-42°C and colonies with characteristic grape-like smell of aminoacetophenone. The blue-green appearance of pus or of an organism culture is pertaining to the combination of pyocyanin (blue pigment) and pyoverdin (fluorescein, yellow pigment). Other pigments such as pyorubin (red) or pyomelanin (brown) was produced by several strains. Almost all strains are motile by means of a single polar flagellum. At least six colonial types were produced by P. aeruginosa on nutrient agar after 24hr aerobic incubation at 37°C. Colonies isolated on selective or blood agar identified by a positive oxidase reaction, Gelatinase positive reaction and characteristic pigment production as ‘P. aeruginosa’79

Resistant Gene detection in ESKAPE pathogens
By AccuPrep Genomic DNA extraction kit (cat.no.k-3032 lot no.1008J, BIONEER) DNA was extracted from all GBS isolates. PCR amplification profile comprised a 300 nM concentration of each oligonucleotide primer (Eurofins MWG Operon); 200 mM (each) deoxynucleoside triphosphates dCTP, dGTP, dATP, and dUTP; 0.125 U of Taq DNA polymerase; and 5.5 mM MgCl2 (from GENET BIO, prime Taq TM DNA polymerase,URL:www.genetbio.com)

The PCR products were analyzed by gel electrophoresis on 1.5% BIONEER agarose gels in 1X TBE buffer (890 mM of boric acid, 890 mMTris, 40ml of 0.5 M EDTA, pH 8.0) at 100 V for 60 min. Green loading buffer with DNA stain(Jena Bioscience, Lot:111.034) was used during loading the samples and ladder. The sizes of the PCR products were determined by comparison with the molecular size standard (50bp-1Kb linear scale; low range DNA ladder or 100bp-3Kb linear scale and mid-range DNA ladder, Jena Bioscience. The rPSL gene was used for each reaction as housekeeping control gene primer sequences used in this study were presented in table 1.

RESULTS

In this study, 384 bacteria were isolated from clinical samples. We examined trachea 29 (7.5%), urine 74(19.27%), wound 44(11.45%), discharges 37(9.63%), ascites 26(6.77%), pleural effusion 25(6.5%), blood 87(22.66%), synovial fluid 31(8.07%), and catheter 31(8.07%) in Loghman-Hakim Hospital, Tehran, Iran. We isolated 22(5.72%) Enterococcus faecium, 73(19.01%) Staphylococcus aureus, 98(25.52%) Klebsiella pneumonia, 37(9.63%) Acinetobacter baumanii, 85(22.13%) Pseudomonas aeroginosa 69(17.96%) Enterobacter spp.

According to CDC definition, MDRs are described as microorganisms that are resistant to one or more classes of antimicrobial drugs. The prevalence of MDR-strains of Enterococcus faecium, Staphylococcus aureus, Klebsiella pneumoniae, Acinetobacter baumannii, Pseudomonas aeruginosa, Enterobacter spp. were 3(9.09%), 17(23.3%), 11(11.22%), 18(18.36%), 9(18.91%), 4(5.8%), respectively.

Antibiotic resistance pattern  about Enterococcus faecium was ampicillin 14(63.63%), penicillin 17(77.27%), nitrofurantoin 16(72.72%), tetracycline 19(86.36%), linezolid 1(4.54%), vancomycin 4(18.18%), gentamicin 10(45.45%), streptomycin 5(22.72%), ciprofloxacin 21(95.45%).

Staphylococcus aureus strains resistant pattern were following as: Erythromycin 69(94.52%), clindamycin57(78.08%), SXT 47(64.38%), vancomycin 2(2.74%), ciprofloxacin 71(97.26%), gentamicin 42(57.56%), minocycline 38(52.05%), rifampicin 51(69.86%), amikacin 64(87.67%), kanamycin 67(91.78%), oxacillin 36(49.31%), penicillin 72(98.63%). All of isolates were sensitive to linezolid.

Klebsiella pneumonia isolates  were resistant to ampicillin 71(72.44%), cefazolin 84(85.71%), gentamicin 66(67.34%), tobramycin 22(22.44%), amikacin 39(39.79%), cefepime 19(19.38%), ceftriaxone 21(21.42%), ciprofloxacin 47(47.95%), imipenem 51(51.04%), meropenem 37(37.75%), piperacillin 87(88.77%).

Antibiotic resistant pattern against to Acinetobacter baumannii were ceftazidime 34(91.89%), ciprofloxacin 33(89.19%),  imipenem 28(75.67%), meropenem 32(86.48%), gentamycin 27(72.97%), tobramycin 25(67.57%), amikacin 36(97.29%), cefepime 35(94.59%), ceftriaxon 36(97.29%), tetracycline 20(54.05%), piperacillin 1(2.7%). All strains were resistant to SXT.

In evaluation of resistant pattern of Pseudomonas aeruginosa we detected gentamicin 65(76.47%), tobramycin 14(16.47%), amikacin 65(76.47%), cefepime 13(15.29%), ciprofloxacin 66(77.64%), imipenem 63(74.12%), meropenem 69(81.17%), piperacillin 45(52.94%), aztreonam 25(29.41%), ceftazidim 39(45.88%)

The resistant pattern of antimicrobial drugs about Enterobacter spp. were ampicillin 68(98.55%), cefazolin 67(97.1%), gentamicin 5(7.25%), tobramycin 4(5.79%), amikacin 2(2.89%), cefepime 43(62.32%), ceftriaxone 39(56.52%), ciprofloxacin 12(17.39%), imipenem 1(1.45%), meropenem 1(1.45%), piperacillin 3(4.35%).

Based on table 1, the most prevalence of resistant genes in ESKAPE bacteria were following as: vanA 40.90%, vanB 22.72% in Enterococcus faecium; mecA 24.65%, vanA 4.11%, vanB 1.37% in Staphylococcus aureus; bla TEM 28.57,blaKPC 12.24% in Klebsiella pneumonia; blaSHV 56.75%, blaVIM 32.43%, bla TEM 29.73 % in Acinetobacter baumannii; blaSHV 44.70%, bla OXA 55.29%, blaVEB 74.11%, blaVIM 62.35%, blaPER 62.35%, Mex-A 74.11%, Mex-B 81.17%, Mex-R76.47%, blaPER 62.35% in Pseudomonas aeruginosa; bla TEM 39.13%, blaSHV 33.33% in Enterobacter spp.

Table (1):
Primer sequences and PCR condition were presented in this study

Genes
Oligonucleotide sequences (52 to 32)
Size (Bp)
Ref.
blaTEM
GGGACARTCSKATGAATGTCA GGGYSGCTTAGATAGTGCTG AT
425
80
blaSHV
GGTTATGCGTTATATTCGCC TTAGCGTTGCCAGTGCTC
867
81
blaOXA
ACACAATACATATCAACTTCGC AGTGTGTTTAGAATGGTGATC
885
82
blaCTX-M
ATGTGCAGYACCAGTAARGT TGGGTRAARTARGTSACCAGA
593
81
blaDHA
CACACGGAAGGTTAATTCTGA CGGTTATACGGCTGAACCTG
970
83
blaVIM
CTTCATTCACGCACTATTAC TAACTTGACCGACAGAGG
827
84
blaPER
ATTCGTATGCTGGATCTCGCCACC CATGACCCAGTTCGCCATATCCTG
396
84
blaFOXUP
AGTGGTGAGTATCCGACAG ATGAAAGTGCGTGGAGAC
225
84
blaGES
GGTCAAGGATCTGGATTTGG ACATGCGTGTAAATCATCGTC
500
84
blaNHAmp C
CACCACGAGAATAACC
GCCTTGAACTCGACCG
1184
84
blaVEB
CGACTTCCATTTCCCGATGC GGACTCTGCAACAAATACGC
1014
85
blaSPM-1
GTACAAGGGATTCGGCATCG
TGGCCTGTTCCCATGTGAG
569
86
blaKPC
TCTGGACCGCTGGGAGCTGG
TGCCCGTTGACGCCCAATCC
87
blaIMP
GGAATAGAGTGGCTTAAYTCTCCCA AACYACTASGTTATCT
188
88
Mex-A
CTCGACCCGATCTACGTC GTCTTCACCTCGACACCC
503
89
Mex-B
TGTCGAAGTTTTTCATTGAG
AAGGTCAC GGTGATGGT
280
89
Mex-R
GAACTACCCCGTGAA TC CACTGGTCGAGGAGATGC
411
89
OprM
GATCCCCGACTACCAGCGCCCCG ATGCGGTACTGCGCCCGGAAGGC
247
89
OprD
ATCTACCGCACAAACGATGAG GCCGAAGCCGATATAATCAAACG
156
89
rPsL
GCAAGCGCATGGTCGACAAGA CGCTGTGCTCTTGCAGGTTGTGA
201
89
mecA
TCCAGATTACAACTTCACCAGG
CCACTTCATATCTTGTAACG
162
90
vanA
CATGAATAGAATAAAAGTTGCAATA
CCCCTTTAACGCTAATACGATCAA
1030
91
vanB
GTGACAAACCGGAGGCGAGGA
CGCCATCCTCCTGCAAAAAA
433
82
vanC
ATCCAAGCTATTGACCCGCT
TGTGGCAGGATCGTTTTCAT
402
93
vanC-2/3
ATCCAAGCTATTGACCCGCT
GTAGGAGCACTGCGGAACAA
582
93

Statistics: Data were analyzed using IBM TM SPSS 20 software.

Table (2):
The prevalence of resistance genes related to multiple drug resistance in ESKAPE pathogens

Genes
E. faecium N (%)
S. aureus N (%)
K. pneumonia N (%)
A. baumanii N (%)
P. aeroginosa N (%)
Enterobacter spp. N (%)
blaTEM
NT
NT
28(28.57)
11(29.73)
12(14.11)
27(39.13)
blaSHV
NT
NT
11(11.22)
21(56.75)
38(44.70)
23(33.33)
blaOXA
NT
NT
5(5.10)
2(5.40)
47(55.29)
12(17.39)
blaCTX-M
NT
NT
6(6.12)
1(2.70)
5(5.88)
12(17.39)
blaDHA
NT
NT
6(6.12)
1(2.70)
13(15.29)
8(11.59)
blaVEB
NT
NT
4(4.08)
1(2.70)
63(74.11)
3(4.35)
blaGES
NT
NT
7(7.14)
0
24(28.23)
2(2.9)
blaVIM
NT
NT
8(8.16)
12(32.43)
53(62.35)
2(2.9)
blaFOXUP
NT
NT
6(6.12)
1(2.70)
11(12.94)
7(10.14)
blaNHAmp C
NT
NT
5(5.10)
1(2.70)
5(5.88)
7(10.14)
blaPER
NT
NT
5(5.10)
1(2.70)
53(62.35)
3(4.35)
blaIMP
NT
NT
4(4.08)
0
14(16.47)
3(4.35)
blaSPM
NT
NT
1(1.02)
0
0
2(2.9)
blaKPC
NT
NT
12(12.24)
NT
5(5.88)
7(10.14)
Mex-A
NT
NT
NT
NT
63(74.11)
NT
Mex-B
NT
NT
NT
NT
69(81.17)
NT
Mex-R
NT
NT
NT
NT
65(76.47)
NT
OprM
NT
NT
NT
NT
19(22.35)
NT
OprD
NT
NT
NT
NT
25(29.41)
NT
rPsL
NT
NT
NT
NT
NT
mecA
NT
18(24.65)
NT
NT
NT
NT
vanA
9(40.90)
3(4.11)
NT
NT
NT
NT
vanB
5(22.72)
1(1.37)
NT
NT
NT
NT
vanC
1(4.54)
0
NT
NT
NT
NT
vanC-2/3
1(4.54)
0
NT
NT
NT
NT

NT: not tested.

DISCUSSION

Health crisis of ESKAPE pathogens seems overwhelming. It is necessary that the last remaining antimicrobial agents be protected against intellectual choice and ameliorated infection control. Selection of suitable guidelines is readily accessible and accurate prescribing protocols have been successfully implemented worldwide2 Briefly, healthcare-associated, community-acquired, and nosocomial infections should be carefully considered. Knowledge of residential antimicrobial resistance can protect the selection of a convenient empirical therapeutic regimen in which diseases due to ESKAPE pathogens94

For appropriate therapy, knowing the antibiotic resistance pattern in ESKAPE pathogens is essential, therefore we examined the distribution of antibiotic resistance in mentioned microorganisms. To our knowledge, this is the first assessment of the ESKAPE pathogens in Iran. There were different results about the resistant pattern of antibiotics in ESKAPE pathogens.

The prevalence of MDR-strains of ESKAPE pathogens were following as: Enterococcus faecium, Staphylococcus aureus, Klebsiella pneumoniae, Acinetobacter baumannii, Pseudomonas aeruginosa, Enterobacter spp.  were 3(9.09%), 17(23.3%), 11(11.22%), 18(18.36%), 9(18.91%), 4(5.8%), respectively.

We reported that antibiotic resistance pattern about Enterococcus faecium was ampicillin 14(63.63%), penicillin 17(77.27%), nitrofurantoin 16(72.72%), tetracycline 19(86.36%), linezolid 1(4.54%), vancomycin 4(18.18%), gentamicin 10(45.45%), streptomycin 5(22.72%), ciprofloxacin 21(95.45%). Increasing antibiotic resistance in common bacterial pathogens, in both hospitals and communities, present a growing threat to human health worldwide. VRE is an important subject in health care setting. Accompany with increased spread, their ability to transfer resistance genes related to vancomycin to other bacteria (such as  MRSA) have bring up them as a subject of discussion and intense study. In our study, the Enterococci were most resistant to several antibiotics that were different with the other studies72,95-99.

As above mentioned, Staphylococcus aureus strains resistant pattern were following as: Erythromycin 69(94.52%), clindamycin 57 (78.08%), SXT 47(64.38%), vancomycin 2(2.74%), ciprofloxacin 71(97.26%), gentamicin 42(57.56%), minocycline 38(52.05%), rifampicin 51(69.86%), amikacin 64(87.67%), kanamycin 67(91.78%), oxacillin 36(49.31%), penicillin 72(98.63%). All of isolates were sensitive to linezolid.

The worldwide emergence of MRSA is a remarkable challenge for public health based on centers for disease control (CDC) reports, 1% of all Staphylococcal in­fections and 50% of healthcare-associated Staphylococcal infections are caused by MRSA74

There is different prevalence of MRSA in the world. Twelve percent of MRSA strains were detected in 2015 in PIRC Tehran, Iran,74 11.3% in Germany, in 2007, (100) and 17.57% west of Iran, in 2013 (101). Compared to studies in Germany (6.5%), The Nether­lands (1.4%), Shiraz, Iran (5.3%), Pediatric Infections Re­search Center, Shahid Beheshti University of Medical Sciences, Tehran, Iran (3.2%), Switzerland (3.3%), the USA (3.4%), France (6.6%) and the UK (6.7%), the prevalence of MRSA strains were lower than in our study (102-109). Rezaei et al. considered colonization of  MRSA and MSSA  in atopic dermatitis patients. They found a higher rate (33%) of MRSA colonization in the nasal cavity. The MRSA was one of the most frequent organisms that were found on their skin.110 The MRSA iso­lates showed variable resistance to clindamycin, ceftri­axone, cefpodoxime, azithromycine, and erythromycin.111 Resistance to penicillin and clindamycin111,112 was similar with the other studies.

By definition, all MRSA isolates can take the mecA gene, which allows resistance to all ²-lactam drugs, containg cephalosporins and carbapenems. In our study and in similar studies, several MRSA are susceptible to a number of beta lactams, such as cephalosporins.113-115

Klebsiella pneumonia isolates were resistant to ampicillin 71(72.44%), cefazolin 84(85.71%), gentamicin 66(67.34%), tobramycin 22(22.44%), amikacin 39(39.79%), cefepime19(19.38%), ceftriaxone 21(21.42%), ciprofloxacin 47(47.95%), imipenem 51(51.04%), meropenem 37(37.75%), piperacillin 87(88.77%).

The other of own studies in 2012, in consideration of 19 ESBL producing K. pneumonia, the frequency of gene groups were detected as following: blaCTX (94.73%), blaTEM (94.73%), and blaSHV (78.94%)77

In Gholipour A and et al study, ESBL genes were detected in 18.75% of E. coli and K. pneumonia isolates. They identified the blaTEM gene was detected in 12.14% of E. coli, in the event that it was not diagnosed in K. pneumonia. The blaSHV gene was identified in 7.47% of E. coli and 14.28% of K. pneumonia isolates. The lowest rates of resistance were detected for: tazocin (6.25%), amikacin (12.5%) and gentamicin (14.84%). Resistance to other ones were as follows: “nitrofurantoin (16.4%), nalidixic acid (23.43), co-trimoxazole (25%), cefepime (32%), ciprofloxacin (55.46%), ceftazidime (59.76%), ampicillin (69.53%) and cefotaxime (73.43%)”116

According to Abujnah AA and et al study in 2015, they reported that Klebsiella spp. were 100% resistant to ampicillin, 33.3% to ceftriaxone, and 17.4% to ciprofloxacin. Forty two percent of Klebsiella spp. isolates were MDR. Totally; blaTEM gene was identified in 7 isolates, blaOXA gene in 10 isolates and blaCTX-M gene in 6 isolates. We could not recognized blaSHV gene in the present study117

Antibiotic resistant pattern against to Acinetobacter baumannii were recognized ceftazidime 34(91.89%), ciprofloxacin 33(89.19%), imipenem 28(75.67%), meropenem 32(86.48%), gentamycin 27(72.97%), tobramycin 25(67.57%), amikacin 36(97.29%), cefepime 35(94.59%), ceftriaxon 36(97.29%), tetracycline 20(54.05%), piperacillin 1(2.7%). All strains were resistant to SXT.

According to Safaria M and et al. study, they recognized 87(87%), 95(95%), 98(98%) and 95(95%) out of 100 A. baumannii isolates were resistant to imipenem, meropenem, ceftazidime and cefotaxime, respectively. Also, phenotypically, 99% and 7% of the isolates were MBLs and ESBLs produced. Out of 100 A. baumannii isolates, 13(30%) harbor the blaVIM-family and 20(20%) and 58(58%) have been confirmed to carry TEM and SHV genes, respectively118

In evaluation of resistant pattern of Pseudomonas aeruginosa were detected that gentamicin65 (76.47%), tobramycin14 (16.47%), amikacin65 (76.47%), cefepime13 (15.29%), ciprofloxacin 66(77.64%), imipenem 63(74.12%), meropenem 69(81.17%), piperacillin 45(52.94%), aztreonam 25(29.41%), ceftazidim 39(45.88%). Thus, studies in large-scale surveillance have keep in sight the alteration in P. aeruginosa susceptibilities pattern over time but have not figured out the underlying mechanisms responsible for the enhancement in P. aeruginosa resistance119-122

The resistant pattern of antimicrobial drugs about Enterobacter Spp. were ampicillin 68(98.55%), cefazolin 67(97.1%), gentamicin 5(7.25%), tobramycin 4(5.79%), amikacin 2(2.89%), cefepime 43(62.32%), ceftriaxone 39(56.52%), ciprofloxacin 12(17.39%), imipenem 1(1.45%), meropenem 1(1.45%), piperacillin 3(4.35%).

The ESBL propagation in Enterobacter spp. was approximately twofold as high as in compare with the ESBL outbreak in invasive E. coli and Klebsiella pneumonia isolates from the identical period in the Netherlands (4.7% and 6.9%, respectively). A presumably description for this diversity was the absence of a laboratory protocol for ESBL tracing in Enterobacter spp., eventuating in a lack of infection control measures and then an increased likelihood of nosocomial outbreak. Of the ESBL-producing strains, 40% were MDR, i.e., altogether resistant to ciprofloxacin, cotrimoxazole, and tobramycin or gentamicin, versus 3% in the non-ESBL isolates. With enhancing of MDR strains will increase the utilization of carbapenems; an unfavorable expansion in the face of the universal emergence of carbapenemase-producing Enterobacteriaceae strains123,124.

It should be mentioned that the clinical response of a patient after receiving antibiotic does not always correlate with the laboratory reports. Even so, it should be noted that description of pathogens antimicrobial resistance patterns needs a consecutive update.125

CONCLUSION

Similar to other developing countries, antimicrobial resistance pattern surveillance has not been awarded sufficient regard in our country. Outcomes of present study demonstrated that the rate of antibiotics resistance is growing in Iranian health care setting. So, Iranian health ministry should provide guideline protocol and appropriate programs for antibiotic therapy in hospitals particularly alongside the other physicians for prescribing suitable antibiotics for antibiotic resistance prevention, better remedy and evaluation of the patients soon. In addition, educational and medical systems in Iran need training some well-educated personnel on the prohibition and management of antibiotic resistance. Knowledge of resistance genes associated with ESKAPE pathogens is necessary to prepare useful data about tracing and treatment of infection related to these microorganisms and may be beneficial to clinicians for selection a convenient empirical therapeutic diet in diseases due to ESKAPE pathogens at the bed head. Surveillances of healthcare setting, community-acquired, and nosocomial infections is suggested annually. We must enhance hospital infection-control procedure for restricting resistance spread. This procedure will ensure a steady stream of new antibacterial drugs to meet the needs of current patients. Further research needed in this regards in Iran.

Declarations

ACKNOWLEDGMENTS
This research has been supported by Research center Laboratory of Paramedical Sciences, Shahid Beheshti University of Medical Sciences, Tehran, Iran. A special thanks to Dr. Mir Davoud Omrani, Dr Ali Rahimipour for all their assistance.

References
  1. Navidinia M. The clinical importance of emerging ESKAPE pathogens in nosocomial infections. J. Paramed. Sci, 2016; 7: 45-57.
  2. Pendletona JN, Gormana SP, Gilmore BF .Clinical relevance of the ESKAPE pathogen. Expert. Rev. Anti. Infect .Ther ., 2013; 11:297-308.
  3. Kafil HS, Asgharzadeh M. Vancomycin-Resistant Enteroccus faecium and Enterococcus faecalis isolated from Education Hospital of Iran. MAEDICA, 2014; 9: 323-27.
  4. Bourgogne A, Singh KV, Fox KA, Pflughoeft KJ, Murray BE, Garsin DA.EbpR is important for biofilm formation by activating expression of the endocarditis and biofilm-associated pilus operon (ebpABC) of Enterococcus faecalis OG1RF. J. Bacteriol ., 2007; 189:6490-93.
  5. Giacometti A, Cirioni O, Schimizzi AM, Del Prete MS, Barchiesi F, D’Errico MM, et al. Epidemiology and microbiology of surgical wound infections. J. Clin. Microbial., 2000; 38:918- 22.
  6. Higaki S, Morohashi M, Yamagishi T. Isolation of Enterococcus species from infectious skin lesions. Drugs. Exp. Clin. Res., 2002; 28:91-3.
  7. Bonten MJ, Willems R, Weinstein RA. Vancomycin-resistant enterococci: Why are they here, and where do they come from? Lancet. Infect. Dis., 2001; 1:314- 25.
  8. Adhikari L. High-level aminoglycoside resistance and reduced susceptibility to vancomycin in nosocomial enterococci. J. Glob. Infect. Dis., 2010; 2:231- 35.
  9. Cetinkaya Y, Falk P, Mayhall CG. Vancomycin-resistant enterococci. Clin. Microbiol. Rev., 2000; 13:686-707.
  10. Protonotariou E1, Dimitroulia E, Pournaras S, Pitiriga V, Sofianou D, Tsakris A. Trends in antimicrobial resistance of clinical isolates of Enterococcus faecalis and Enterococcus faecium in Greece between 2002 and 2007. J. Hosp. Infect., 2010; 75:225-7.
  11. Sofianou D, Pournaras S, Giosi M, Polyzou A, Maniatis AN, Tsakris A. Substantially increased E. faecalis carriage of vancomycin-resistant enterococci in a tertiary Greek hospital after a 4 year time interval. J .Antimicrob .Chemother., 2004; 54:251-4.
  12. Souli M, Sakka V, Galani I, Antoniadou A, Galani L, Siafakas N,et al.Colonisation with vancomycin- and linezolid-resistant Enterococcus faecium in a university hospital: molecular epidemiology and risk factor analysis. Int. J .Antimicrob .Age., 2009; 33:137-42.
  13. Kang M, Xie Y, He C, Chen ZX, Guo L, Yang Q, et al. Molecular characteristics of vancomycin-resistant Enterococcus faecium from a tertiary care hospital in Chengdu, China. Eur. J. Clin. Microbiol .Infect .Dis., 2014; 33:933-9.
  14. Werner G, Klare I, Fleige C, Geringer U, Witte W, Just HM, Ziegler R, et al.Vancomycin-resistant vanB-type Enterococcus faecium isolates expressing varying levels of vancomycin resistance and being highly prevalent among neonatal patients in a single ICU. Antimicrob. Resis.Infect .Con., 2012; 1:21. doi: 10.1186/2047-2994-1-21.
  15. Jamil I, Zafar A, Usman Qamar M, Ejaz H, Akhtar J , Waheed A. Multi-drug resistant Klebsiella pneumoniae causing urinary tract infections in children in Pakistan.Afr. J. Microbiol. Res., 2014; 8: 316-9.
  16. ManchandaV, Sanchaita S, Singh NP. Multidrug Resistant Acinetobacter. J. Glob. Infect. Dis., 2010; 2: 291–304.
  17. Fournier PE, Richet H. The epidemiology and control of Acinetobacter baumannii in health care facilities.Clin. Infect .Dis ., 2006; 42:692–9.
  18. Jawad A, Heritage J, Snelling AM, Gascoyne-Binzi DM, Hawkey PM. Influence of relative humidity and suspending menstrua on survival of Acinetobacter spp. on dry surfaces. J. Clin. Microbial. 1996; 34:2881–7.
  19. Beijerinck M. Pigmenten als oxydatieproducten gevormd door bacterien. Vers. Konin. Akad .Wet. Ams., 1991; 19:1092–1103.
  20. Bouvet PJ, Grimont PA. Taxonomy of the genus Acinetobacter with the recognition of Acinetobacter baumannii sp. nov, Acinetobacter haemolyticus sp. nov, Acinetobacter johnsonii sp. nov and Acinetobacter junii sp. nov and emended description of Acinetobacter calcoaceticus and Acinetobacter lwoffii. Int. J .Syst. Bacteriol., 1986; 36:228–40.
  21. Gerner-Smidt P. Ribotyping of the Acinetobacter calcoaceticusAcinetobacter baumannii complex. J. Clin. Microbiol ., 1992; 30:2680–5.
  22. Gerner-Smidt P, Tjernberg I, Ursing J. Reliability of phenotypic tests for identification of Acinetobacter species. J .Clin .Microbiol ., 1991; 29:277–82.
  23. Bergogne-Bérézin E, Towner KJ. Acinetobacter spp. as nosocomial pathogens: microbiological, clinical, and epidemiological features. Clin. Microbiol. Rev., 1996; 9:148–165.
  24. Lessel EF. Minutes of the Subcommittee on the Taxonomy of Moraxella and Allied Bacteria. Int. J .Syst. Bacteriol., 1971; 21:213–4.
  25. Bouvet PJ, Jeanjean S. Delineation of new proteolytic genomic species in the genus Acinetobacter. Res. Microbiol ., 1989; 140: 291–9.
  26. Tjernberg I, Ursing J. Clinical strains of Acinetobacter classified by DNA-DNA hybridization. APMIS, 1989; 97:596–605.
  27. Hirsch B , Tam VH . Impact of multidrug-resistant Pseudomonas aeruginosa infection on patient outcomes Elizabeth. Expert. Rev .Pharmacoecon .Outcomes. Res ., 2010; 10: 441–451.
  28. Gales AC, Jones RN, Turnidge J, Rennie R, Ramphal R. Characterization of Pseudomonas aeruginosa isolates: occurrence rates, antimicrobial susceptibility patterns, and molecular typing in the global SENTRY Antimicrobial Surveillance Program, 1997–1999. Clin. Infect. Dis., 2001; 32: 146–55.
  29. Tam VH, Chang KT, Abdelraouf K, Brioso CG, Ameka M, McCaskey LA, et al. Prevalence, resistance mechanisms, and susceptibility of multidrug-resistant bloodstream isolates of Pseudomonas aeruginosa. Antimicrob. Age. Chemother., 2010; 54:1160–64.
  30. Hartzell JD, Neff R, Ake J, Howard R, Olson S, Paolino K, et al.Nephrotoxicity associated with intravenous colistin (colistimethate sodium) treatment at a tertiary care medical center. Clin. Infect .Dis., 2009; 48:1724–8.
  31. Kim J, Lee KH, Yoo S, Pai H. Clinical characteristics and risk factors of colistin-induced nephrotoxicity. Int . J .Antimicrob .Agents ., 2009;  34:434–8.
  32. Falagas ME, Kasiakou SK. Toxicity of polymyxins: a systematic review of the evidence from old and recent studies. Crit. Care ., 2006; 10:R27.
  33. Cosgrove SE, Vigliani GA, Fowler VG Jr, Abrutyn E, Corey GR, Levine DP,et al. Initial low-dose gentamicin for Staphylococcus aureus bacteremia and endocarditis is nephrotoxic. Clin. Infect. Dis., 2009; 48:713–21.
  34. Zavascki AP, Goldani LZ, Li J, Nation RL. Polymyxin B for the treatment of multidrug-resistant pathogens: a critical review. J .Antimicrob. Chemother., 2007; 60:1206–15.
  35. Yuan Z, Tam VH. Polymyxin B: a new strategy for multidrug-resistant Gram-negative organisms. Expert .Opin. Investig. Drugs., 2008; 17:661–8.
  36. Li J, Nation RL, Turnidge JD, Milne RW, Coulthard K, Rayner CR, et al. Colistin: the re-emerging antibiotic for multidrug-resistant Gram-negative bacterial infections. Lancet. Infect. Dis., 2006; 6:589–601.
  37. Livermore DM. Multiple mechanisms of antimicrobial resistance in Pseudomonas aeruginosa: our worst nightmare? Clin. Infect. Dis., 2002; 34:634–40.
  38. Bonomo RA, Szabo D. Mechanisms of multidrug resistance in Acinetobacter species and Pseudomonas aeruginosa. Clin. Infect. Dis., 2006; 43: 49–56.
  39. Li XZ, Nikaido H. Efflux-mediated drug resistance in bacteria. Drugs., 2004; 64:159–204.
  40. Li XZ, Nikaido H. Efflux-mediated drug resistance in bacteria: an update. Drugs., 2009; 69: 1555–623.
  41. Li XZ, Barre N, Poole K. Influence of the MexA-MexB-oprM multidrug efflux system on expression of the MexC-MexD-oprJ and MexE-MexF-oprN multidrug efflux systems in Pseudomonas aeruginosa. J. Antimicrob. Chemother., 2000; 46: 885–93.
  42. Poole K. Efflux-mediated multiresistance in Gram-negative bacteria. Clin. Microbiol. Infect ., 2004; 10:12–26.
  43. Kotra LP, Haddad J, Mobashery S. Aminoglycosides: perspectives on mechanisms of action and resistance and strategies to counter resistance. Antimicrob. Agents .Chemother., 2000; 44: 3249–56.
  44. Doi Y, Arakawa Y. 16S ribosomal RNA methylation: emerging resistance mechanism against aminoglycosides. Clin. Infect. Dis ., 2007; 45:88–94.
  45. Doi Y, Wachino J, Arakawa Y. Nomenclature of plasmid-mediated 16S rRNA methylases responsible for panaminoglycoside resistance. Antimicrob. Agents .Chemother., 2008; 52:2287–8.
  46. Galimand M, Sabtcheva S, Courvalin P, Lambert T. Worldwide disseminated armA aminoglycoside resistance methylase gene is borne by composite transposon Tn1548. Antimicrob. Agents. Chemother., 2005; 49:2949–53.
  47. Yamane K, Wachino J, Doi Y, Kurokawa H, Arakawa Y. Global spread of multiple aminoglycoside resistance genes. Emerg. Infect. Dis. 2005;  11:951–3.
  48. Tam VH, Schilling AN, LaRocco MT, Gentry LO, Lolans K, Quinn JP ,et al .Prevalence of AmpC over-expression in bloodstream isolates of Pseudomonas aeruginosa. Clin. Microbiol. Infect., 2007; 13:413–8.
  49. Jalal S, Ciofu O, Hoiby N, Gotoh N, Wretlind B. Molecular mechanisms of fluoroquinolone resistance in Pseudomonas aeruginosa isolates from cystic fibrosis patients. Antimicrob. Agents .Chemother., 2000; 44:710–12.
  50. Andersson DI. The biological cost of mutational antibiotic resistance: any practical conclusions? Curr. Opin. Microbiol., 2006; 9:461–5.
  51. Ramadhan AA, Hegedus E. Survivability of vancomycin resistant enterococci and fitness cost of vancomycin resistance acquisition. J. Clin. Pathol, 2005; 58:744–6.
  52. Criswell D, Tobiason VL, Lodmell JS, Samuels DS. Mutations conferring aminoglycoside and spectinomycin resistance in Borrelia burgdorferi. Antimicrob. Agents. Chemother., 2006; 50: 445–452.
  53. Deptula A, Gospodarek E. Reduced expression of virulence factors in multidrug-resistant Pseudomonas aeruginosa strains. Arch. Microbiol., 2009; 192:79–84.
  54. Sánchez P, Linares JF, Ruiz-Díez B, Campanario E, Navas A, Baquero F, et al.Fitness of in vitro selected Pseudomonas aeruginosa nalB and nfxB multidrug resistant mutants. J. Antimicrob. Chemother., 2002; 50:657–64.
  55. Cao B, Wang H, Sun H, Zhu Y, Chen M. Risk factors and clinical outcomes of nosocomial multidrug resistant Pseudomonas aeruginosa infections. J. Hosp.  Infect., 2004; 57:112–18.
  56. ArabestaniMR,Rajabpour M,Yousefi Mashouf R,Alikhani MY,Mousavi SM. Expression of Efflux Pump MexAB-OprM and OprD of Pseudomonas aeruginosa Strains Isolated from Clinical Samples using qRT-PCR .Arch. Iran. Med , 2015; 18:102-8.
  57. Jaffe RI, Lane JD, Bates CW. Pseudomonas aeruginosa direct from clinical samples using a rapid extraction method and polymerase chain reaction (PCR). J. Clin. Lab. Anal., 2001; 15:131-7.
  58. Vanhems P, Lepape A, Savey A, Jambou P, Fabry J. Nosocomial pulmonary infection by antimicrobial resistant bacteria of patients hospitalized in intensive care units risk factors and survival. J. Hosp. Infect., 2000; 98 – 106.
  59. Poole K .Efflux-Mediated Resistance to Fluoroquinolones in Gram-Negative Bacteria Antimicrob. Agents. Chemother., 2000; 44: 2233–41.
  60. Lomovskaya O1, Warren MS, Lee A, Galazzo J, Fronko R, Lee M, et al.Identification and characterization of inhibitors of multidrug resistance efflux pumps in Pseudomonas aeruginosa: novel agents for combination therapy. Antimicrob. Agents. Chemother., 2001; 45:105-16.
  61. Saier MH Jr, Paulsen I. Phylogeny of multidrug transporters. Semin. Cell. Dev. Biol., 2001; 205 –13.
  62. Poole K, Tetro K, Zhao Q, Neshat S, Heinrichs DE, Bianco N. Expression of the multidrug resistance operon MexA-mexB-oprM in Pseudomonas aeruginosa mexR encodes a regulator of operon expression. Antimicrob. Agents .Chemother. 1996; 40: 2021 –28.
  63. Saito K1, Yoneyama H, Nakae T. NalB-type mutations causing the overexpression of the MexAB-OprM efflux pump are located in the mexR gene of the Pseudomonas aeruginosa chromosome. FEMS. Microbiol .Lett ., 1999; 179(1):67-72.
  64. Quinn JP, Dudek EJ , DiVincenzo CA , Lucks DA , Lerner SA. Emergence of resistance to imipenem during therapy for Pseudomonas aeruginosa infections. J. Infect. Dis ., 1986; 154: 289 –94.
  65. Quale J1, Bratu S, Gupta J, Landman D. Interplay of efflux system, ampC, and oprD expression in carbapenem resistance of Pseudomonas aeruginosa clinical isolates. Antimicrob. 2006; 50:1633-41.
  66. http://tinyurl.com/crwv3gg .Health Protection Agency. Enterobacter species.
  67. Castanheira M, Deshpande LM, Mathai D, Bell JM, Jones RN, Mendes RE. Early dissemination of NDM-1- and OXA-181-producing Enterobacteriaceae in Indian hospitals: report from the SENTRY Antimicrobial Surveillance Program, 2006–2007.Antimicrob. Agents. Chemother., 2011; 55:1274–8.
  68. Macrae MB, Shannon KP, Rayner DM, Kaiser AM, Hoffman PN, French GL. A simultaneous outbreak on a neonatal unit of two strains of multiply antibiotic resistant Klebsiella pneumoniae controllable only by ward closure. J. Hosp. Infect., 2001; 49:183–92.
  69. Castanheira M, Deshpande LM, Mathai D, Bell JM, Jones RN, Mendes RE. Early dissemination of NDM-1- and OXA-181- producing Enterobacteriaceae in Indian hospitals: report from the SENTRY Antimicrobial Surveillance Program, 2006–2007. Antimicrob. Agents. Chemother., 2011; 55: 1274–8.
  70. Gibsona JS , Cobbolda RN, Heisigb P, Sidjabatc HE, Kyaw-Tannera MT , Trotta DJ . Identification of Qnr and AAC (62 )-1b-cr plasmid-mediated fluoroquinolone resistance determinants in multidrug-resistant Enterobacter spp. isolated from extraintestinal infections in companion animals. Vet. Microbial., 2010; 143:329–36.
  71. Moemen D, Tawfeek D, Badawy W. Healthcare-associated vancomycin resistant Enterococcus faecium infections in the Mansoura University Hospital’s intensive care units. Egypt. Braz. J. Microbiol., 2015; 46: 777-83.
  72. Rafiei Tabatabaei S, Karimi A, Navidinia M, Fallah F, Tavakkoly Fard A, Rahbar M. A study on prevalence of vancomycin-resistant enterococci carriers admitted in a children hospital in Iran .Ann. Biolog. Res., 2012; 3: 5441-5.
  73. Karimi A, Navidinia M, Tabatabaii SR, Fallah F, Malekan M, Jahromy MH, Ahsani RR,Shiva F. The prevalence of Vancomycin resistance genes in enterococci isolated from the stool of hospitalized patients in Mofid children Hospital. Gene. Ther .Mol .Biol ., 2009; 13:294-300.
  74. Navidinia M, Fallah F, Lajevardi B, Shirdoost M , Jamali Epidemiology of Methicillin-Resistant Staphylococcus aureus Isolated From Health Care Providers in Mofid Children Hospital .Arch. Pediatr. Infect. Dis., 2015; 3: e16458. DOI: 10.5812
  75. Till PM. Bailey & Scott’s Diagnostic Microbiology. 13th edMichigan: Mosby; 2013.
  76. Gholipour A, Soleimani N, Shokri D, Mobasherizadeh S, Kardi M, Baradaran A.Phenotypic and Molecular Characterization of Extended-Spectrum ²-Lactamase Produced by Escherichia coli, and Klebsiella pneumonia Isolates in an Educational Hospital. Jundishapur J .Microbiol ., 2014; 7:e11758.
  77. Karimi A, Rahbar M, Fallah F, Navidinia M, Malekan M. Detection of integron elements and gene groups encoding ESBLs and their prevalence in Escherichia coli and Klebsiella isolated from urine samples by PCR method. Afr. J .Microbiol. Res., 2012; 6:1806–9.
  78. Goudarzi M, Seyedjavadi SS, Navidinia M.Distribution of integrons and associated gene cassettes in Acinetobacter baumannii strains isolated from hospitalized patients in intensive care unit in Tehran-Iran .2015 the EMBL/GenBank/DDBJ databases
  79. Jafari M, Fallah F, Borhan RS, Navidinia M, Rafiei Tabatabaei S, Karimi A, et al. The First Report of CMY, aac (62 )-Ib and 16S rRNA Methylase Genes Among Pseudomonas aeruginosa Isolates From Iran. Arch. Pediatr. Infect. Dis., 2013; 1: 109-12.
  80. Cho SH, Young HanS, Kang YH. Possibility of CTX-M-14 Gene Transfer from Shigella sonnei to a Commensal Escherichia coli Strain of the Gastroenteritis Microbiome .Osong. Public .Health. Res. Perspect ., 2014; 5: 156–60.
  81. Elumalai S, Muthu G, Selvam RE, Ramesh S. Detection of TEM-, SHV- and CTX-M-type ²-lactamase production among clinical isolates of Salmonella species.J. Med. Microbiol ., 2014; 63:962-7.
  82. Navidinia M , Armin S ,  Vosoghian S .Prevalence of blaOXA-1 and blaDHA-1 AmpC ²-Lactamase-Producing and Methicillin-Resistant Staphylococcus aureus in Iran. Arch. Ped. Infec. Dis. e36778, DOI: 10.5812/pedinfect.36778
  83. Pai H, Kang CI, Byeon JH,  Lee KD,  Park WB,  Kim HB, et al.Epidemiology and Clinical Features of Bloodstream Infections Caused by AmpC-Type-²-Lactamase-Producing Klebsiella pneumoniae .Antimicrob. Agents. Chemother., 2004; 48: 3720–28.
  84. Hou X, Song X, Ma X, Zhang S, Zhang J .Molecular characterization of multidrug-resistant Klebsiella pneumoniae isolates. Braz. J. Microbiol.; 2015; 46: 759-68.
  85. Weldhagen GF, Poirel L, Nordmann P.Ambler Class A Extended-Spectrum ²-Lactamases in Pseudomonas aeruginosa: Novel Developments and Clinical Impact. Antimicrob. Agents. Chemother.; 2003; 47 :2385-92.
  86. Mendes RE, Kiyota KA, Monteiro J, CastanheiraM, Andrade SS, Gales AC,et al.Rapid Detection and Identification of Metallo-²Lactamase-Encoding Genes by Multiplex Real-Time PCR Assay and Melt Curve Analysis. J. Clin. Microbiol., 2007; 45:544–7.
  87. Chen L, Mediavilla JR,  Endimiani A, Rosenthal ME,  Zhao Y,  Bonomo RA,  Kreiswirth BN. Multiplex Real-Time PCR Assay for Detection and Classification of Klebsiella pneumoniae Carbapenemase Gene (blaKPC) Variants.J. Clin .Microbiol ., 2011; 49: 579–85.
  88. Ellington MJ, Kistler J, Livermore DM, Woodford N .Multiplex PCR for rapid detection of genes encoding acquired metallo-beta-lactamases. J. Antimicrob. Chemother., 2007; 59: 321–2.
  89. Arabestani MR, Rajabpour M, Yousefi Mashouf R, Alikhani MY, Mousavi SM. Expression of Efflux Pump MexAB-OprM and OprD of Pseudomonas aeruginosa Strains Isolated from Clinical Samples using qRT-PCR .Arch. Iran. Med., 2015; 18:102-8.
  90. Navidinia M, Fallah F, Lajevardi B, Shirdoost M, Jamali J. Epidemiology of Methicillin-Resistant Staphylococcus aureus Isolated From Health Care Providers in Mofid Children Hospital. Arch. Ped. Infec. Dis., 2015; 3.
  91. Borhani K, AhmadiA, Rahimi F,  Pourshafie MR,  Talebi M .Determination of Vancomycin Resistant Enterococcus faecium Diversity in Tehran Sewage Using Plasmid Profile, Biochemical Fingerprinting and Antibiotic Resistance. Jundishapur. J. Microbiol., 2014; 7: e8951.
  92. Islam TAB, Shamsuzzaman SM .Prevalence and antimicrobial susceptibility pattern of methicillin-resistant, vancomycin-resistant, and Panton-Valentine leukocidin positive Staphylococcus aureus in a tertiary care hospital Dhaka, Bangladesh. Tzu. Chi. Medical. J., 2015; 27: 10e14
  93. Iweriebor BC, Obi LC, Okoh AI.Virulence and antimicrobial resistance factors of Enterococcus Spp. isolated from fecal samples from piggery farms in Eastern Cape, South Africa .BMC. Microbiol., 2015; 15:136 .DOI: 10.1186/s12866-015-0468-7
  94. Slavcovici A, Maier C, Radulescu A. Antimicrobial Resistance of ESKAPE-Pathogens in Culture-Positive Pneumonia. Farmacia., 2015; 63:201-5.
  95. Kazakova SV, Hageman JC, Matava M, Srinivasan A, Phelan L, Garfinkel B, et al. A clone of methicillin-resistant Staphylococ­cus aureus among professional football players. N. Engl. J. Med., 2005; 352:468–75.
  96. Wagenlehner FM, Naber KG, Bambl E, Raab U, Wagenlehner C, Kahlau D, et al. Management of a large healthcare-associated outbreak of Panton-Valentine leucocidin-positive meticillin-resistant Staphylococcus aureus in Germany. J. Hosp. Infect., 2007; 67:114–20.
  97. Oliveira DC, de Lencastre H. Multiplex PCR strategy for rapid identification of structural types and variants of the mec ele­ment in methicillin-resistant Staphylococcus aureus. Antimicrob. Agents. Chemother., 2002; 46:2155–61.
  98. Mohajeri P, Izadi B, Rezaei M, Farahani A. Frequency Distribution of Hospital-Acquired MRSA Nasal Carriage Among Hospitalized Patients in West of Iran. Jundishapur. J .Microbiol., 2013; 6.
  99. Harbarth S, Sax H, Fankhauser-Rodriguez C, Schrenzel J, Agostin­ho A, Pittet D. Evaluating the probability of previously unknown carriage of MRSA at hospital admission. Am. J. Med., 2006; 119:275 e15–23.
  100. Davis KA, Stewart JJ, Crouch HK, Florez CE, Hospenthal DR. Meth­icillin-resistant Staphylococcus aureus (MRSA) nares coloniza­tion at hospital admission and its effect on subsequent MRSA infection. Clin. Infect. Dis., 2004; 39:776–82.
  101. Rioux C, Armand-Lefevre L, Guerinot W, Andremont A, Lucet JC. Acquisition of methicillin-resistant Staphylococcus aureus in the acute care setting: incidence and risk factors. Infect. Control. Hosp. Epidemiol., 2007; 28:733–6.
  102. Gopal Rao G, Michalczyk P, Nayeem N, Walker G, Wigmore L. Prevalence and risk factors for meticillin-resistant Staphylococ­cus aureus in adult emergency admissions—a case for screening all patients? J. Hosp. Infect., 2007; 66:15–21.
  103. Kock R, Brakensiek L, Mellmann A, Kipp F, Henderikx M, Harmsen D, et al. Cross-border comparison of the admission prevalence and clonal structure of meticillin-resistant Staphylococcus au­reus. J. Hosp. Infect., 2009; 71:320–6.
  104. Armin S, Rouhipour A, Fallah F, Rahbar M, Ebrahimi M. Vanco­mycin and Linezolid Resistant Staphylococcus in Hospitalized Children. Arch. Pediatr. Infect. Dis., 2013; 1:4–8.
  105. Rezaei M, Chavoshzadeh Z, Haroni N, Armin S, Navidinia M, Mansouri M, et al. Colonization With Methicillin Resistant and Methicillin Sensitive Staphylococcus aureus Subtypes in Patients With Atopic Dermatitis and Its Relationship With Sever­ity of Eczema. Arch. Pediatr. Infect. Dis., 2013; 1:53–6.
  106. Rajaduraipandi K, Mani KR, Panneerselvam K, Mani M, Bhaskar M, Manikandan P. Prevalence and antimicrobial susceptibility pattern of methicillin resistant Staphylococcus aureus: a multicenter study. Indian. J. Med. Microbiol., 2006; 24:34–8.
  107. Saikia L, Nath R, Choudhury B, Sarkar M. Prevalence and antimi­crobial susceptibility pattern of methicillin-resistant Staphylo­coccus aureus in Assam. Indian. J. Crit. Care. Med., 2009; 13:156–8.
  108. Shibabaw A, Abebe T, Mihret A. Nasal carriage rate of methicillin resistant Staphylococcus aureus among Dessie Referral Hospital Health Care Workers; Dessie, Northeast Ethiopia. Antimicrob. Re­sist. Infect. Control., 2013; 2:25.
  109. Pandey S, Raza MS, Bhatta CP. Prevalence and Antibiotic Sensi­tivity Pattern of Methicillin-Resistant- Staphylococcus aureus in Kathmandu Medical College. Teaching Hospital. J. Ins. Med., 2012; 34:13–7.
  110. Mir BA. Prevalence and antimicrobial susceptibility of methicil­lin resistance Staphylococcus aureus and coagulase negative Staphylococci in a tertiary care hospital. Asian. J. Pharm. Clin.Res., 2013; 6.
  111. Gholipour A, Soleimani  N, Shokri  D, Mobasherizadeh  S, Kardi  M, Baradaran A. Phenotypic and Molecular Characterization of Extended-Spectrum ²-Lactamase Produced by Escherichia coli, and Klebsiella pneumoniae Isolates in an Educational Hospital. Jundishapur. J .Microbiol., 2014; 7: e11758
  112. Abujnah AA, Zorgani A, Sabri MAM, El-Mohammady H, Khalek RA , Ghenghesh KS. Multidrug resistance and extended-spectrum β-lactamases genes among Escherichia coli from patients with urinary tract infections in Northwestern Libya. Libyan. J. Med., 2015; 10: 26412 – http://dx.doi.org/10.3402/ljm.v10.26412
  113. Safaria M, Mozaffari Nejad AS, Bahadord A, Jafarie R, Alikhania MY. Prevalence of ESBL and MBL encoding genes in Acinetobacter baumannii strains isolated from patients of intensive care units (ICU). Saudi. J .Biolog. Sci ., 2015; 22: 424–9.
  114. Kriengkauykiat J, Porter E, Lomovskaya O, Wong-Beringer A.Use of an Efflux Pump Inhibitor To Determine the Prevalence of Efflux Pump-Mediated Fluoroquinolone Resistance and Multidrug Resistance in Pseudomonas aeruginosa. Antimicrob. Agents. Chemother., 2005; 49: 565–570
  115. Bhavnani S, Callen W, Forrest A, Glilliland K, Collins D, Paladino J, Schentag J. Effect of fluoroquinolone expenditures on susceptibility of Pseudomonas aeruginosa to ciprofloxacin in U.S. hospitals. Am. J. Health. Syst.  Pharm., 2003; 60:1962–1970.
  116. Gales A, Jones R, Turnidge J, Rennie R, Ramphal R. Characterization of Pseudomonas aeruginosa isolates: occurrence rates, antimicrobial susceptibility patterns, and molecular typing in the global SENTRY antimicrobial surveillance program, 1997–1999. Clin. Infect. Dis., 2001; 32: 146–155.
  117. Hill HA, Habe MJ, McGowen JE, Fridkin SK, Edwards JR, Tenover FC, Gaynes RP. A link between quinolone use and resistance in P. aeruginosa. Preliminary data from Project ICARE. Abstracts of the 39th Annual Infectious Diseases Society Meeting. Clin. Infect. Dis., 2001; 33:1173.
  118. Stuart JC, Diederen B, Naiemi N, Fluit A, Arents N, Thijsen S, et al. Method for Phenotypic Detection of Extended-Spectrum Beta-Lactamases in Enterobacter Species in the Routine Clinical Setting. J. Clin. Microbiol., 2011; 49: 2711–13.
  119. Bilavsky, E., M. J. Schwaber, and Y. Carmeli. How to stem the tide of carbapenemase-producing enterobacteriaceae?: proactive versus reactive strategies. Curr. Opin. Infect. Dis., 2010; 23:327–31.
  120. Hirsch EB, Tam VH. Impact of multidrug-resistant Pseudomonas aeruginosa infection on patient outcomes. Expert. Rev. Pharmacoecon. Outcomes. Res., 2010; 10: 441–51.

Article Metrics

Article View: 5522

Share This Article

© The Author(s) 2017. Open Access. This article is distributed under the terms of the Creative Commons Attribution 4.0 International License which permits unrestricted use, sharing, distribution, and reproduction in any medium, provided you give appropriate credit to the original author(s) and the source, provide a link to the Creative Commons license, and indicate if changes were made.