Open Access
Anthony A. Adegoke
Department of Biochemistry and Microbiology, University of Fort Hare, Alice 5700, South Africa.
J Pure Appl Microbiol. 2017;11(3):1409-1414
https://doi.org/10.22207/JPAM.11.3.23 | © The Author(s). 2017
Received: 10/06/2017 | Accepted: 20/08/2017 | Published: 30/09/2017
Abstract

This study was conducted to assess the comparative perspective effects of whole and diluted human breast milk in the face of other changing medical verdicts. The comparative antimicrobial effects of whole and diluted (50%) concentrations of human breast milk were assessed using conventional methods in Microbiology and polymerase chain reaction (PCR). Ten human breast milk samples were collected and tested against 4 isolates of diarrheagenic Escherichia coli (DEC) from stool samples of diarrheal patients. Activity indices of the breast milk with respect to ofloxacin as standard drug were determined. None of the sterility plates for the breast milk samples showed any growth of potential pathogen, but very scanty colonies of Lactic Acid Bacteria (LAB). Whole breast milk showed activity indices that ranged from 0.61 to 1.28 while diluted (50%) showed lower activity indices that ranged from 0 to 0.63. The test isolates, DEC exhibited resistance (percentage resistance) to ciprofloxacin (25%), gentamycin (50%), augmentin (50%), penicillin (75%), cotrimoxazole (100%) and chloramphenicol (100%). Multidrug resistance was also observed among all the test isolates. The whole (exclusive) concentration of breast milk showed much higher antimicrobial effects on the DEC than the diluted (p < 0.01). Due to the high activity in whole breast milk as observed in this study, the need for exclusive breast feeding for safe motherhood, to reduce infantile diarrhoea is once again re-established.

Keywords

Human breast milk, antimicrobial and diarrheagenic Escherichia coli.

Introduction

Breast feeding has overbearing advantages over the infant-formula because of the presence of its rich constituents which guarantee early nourishment and protection against childhood killer diseases1. The human milk serves as the source of immunoglobulin and other protective factors to ward off foreign infective cells2. So, a child is supplied with an array of bioactive factors from milk which includes hormones, growth factors and colony stimulation factors, thus increasing the possibilities for survival and reduction of infantile mortality1.

Breastmilk affords a child the availability of factors necessary in prompt maturation of gastrointestinal mucosa and reduction of infection3, and other factors that interfere with disease pathogenesis. The protective effects of breastfeeding transcend the lactation period, because it serves as the baseline protection while the immune system begins to learn or develop following subsequent exposure2. So, it is generally believed that the breastfed infants are usually better protected than those fed with infant formula. Also, advocacy has been intensified globally that protective breastfeeding is guaranteed when it is exclusive: without water supplement as it has sufficient water a child needs. The protective factor provided include specific antibodies to pathogens, inhibiting gut colonization by gut-philia4. Such antibodies involve involve B-lymphocytes, plasma cells, immunoglobulous and antibodies5.

One of the gut-philic organisms and a threat of gastroenteritis in children and adult is Escherichia coli6,7. The E. coli strains classified as Diarrheagenic Escherichia coli (DEC) are known for their roles in diarrhoea among 6-8. Infant mortality due to diarrhoea accounts for 0.3 of 3.6 million in Africa9. Enterotoxigenic E. coli (ETEC), enteroinvasive E. coli (EIEC), and enterohemorrhagic E. coli (EHEC) are known threat in infantile diarrhoea with high mortality9,10.

This study becomes very important because of the emergence of total antibiotic resistant member of Enterobacteriaceae, in which the bacteria was resistant to the existing 26 antibiotics in the United States11, leading to the death of the patient. The World Health Organization, WHO12 placed some Enterobacteiaceae in the critical priority of those requiring new R and D drugs. The neonates, infants and children who are infected by these types of E. coli may have low survival probability, because the administration of some antibiotics in the last line of defence may be unsafe for them due to toxicity13-15.

While breast feeding has long been known for effective way to check infantile diarrhoea, the practice is on the decline due to misconceptions and lack of recent reference materials on the antibacterial importance of breastfeeding16. This informed the research objectives to evaluate the perspective microbiological quality of the human breast milk.

Materials and Methods

Identification/typing of the test isolates
The DEC was earlier identified, typed and reported in our previous reports17 using the primer in table 1 below, as the same isolates have been used for that other research.

Antibiotic susceptibility testing (AST) of DEC
The standard disc diffusion method following the scheme of Clinical and Laboratory Standard Institute, CLSI18 was employed for AST of the test isolates, DEC using conventional antibiotics. The antibiotics used include those inhibiting the synthesis of the cell wall (penicillin, cotrimoxazole, oxacillin, ceftazime, augmentin), protein (chloramphenicol, gentamycin) and nucleic acid (ofloxacin, ciprofloxacin). Young cultures at log phase were carefully transferred into peptone water which was adjusted to 0.5 McFarland standards (1.5 × 108 CFU/100 mL). The bacterial suspension was carefully spread on solidified Mueller-Hinton (MH) agar (Oxoid, UK) in Petri plate with the aid of sterile cotton-tipped applicator (swab sticks). The resulting culture was place in incubator for 10-15 minutes to ensure the bacterial suspension dries up into the agar. Antibiotic disc were carefully placed on the agar surface at equidistant from each other, using sterile forceps. This was place in the chiller at 4ºC for 10-15 min to ensure proper diffusion of the disc. The resulting cultures were then removed and were incubated at 35ºC ± 2ºC overnight, after which the zones of inhibition were measured. The zones were interpreted using the interpretive manuals of the British Society for Antibiotic Chemotherapy, BSAC19 and minimal inhibitory concentration (MIC) breakpoints for Enterobacteriacea18.

Antimicrobial susceptibility testing of DEC to human breast milk
The agar well diffusion method of Perez et al.,20 and BSAC19 were used with modifications. The test isolates, DEC containing 2 strains ETEC, EIEC and EHEC were used. Mueller-Hinton agar (Oxoid, UK) and a turbidity of the test isolates equivalent to 0.5 McFarland standards (1.5 × 108 CFU/100 mL) were prepared. The bacterial suspension was carefully spread on solidified MH and wells bored using 6 mm cork borer. An exact measure of 0.2 ml of whole (100 %) and diluted (50 %) of the breast milk was introduced in separate wells on the inoculated agar. The resulting cultures were incubated for 35 ºC ± 2 ºC overnight. After incubation, the zones of inhibition were measured and the activity index with respect to positive control (standard antibiotic) determined as the ratio of zone of inhibition by breast milk zone of inhibition by antibiotics / zone of inhibition by standard antibiotics.

Statistical Analysis
One way anova (SPSS, Version 17) was used to determine the significance (p < 0.01) of the difference in the antibacterial activity of the whole and diluted concentration of human breast milk.

RESULTS

The molecular identification whose primers are listed in table 1 shows 2 to be ETEC and the other 2 to be EIEC and EHEC. Human breast milk exhibited high antibacterial activity. Whole breast milk showed activity indices that ranged from 0.61 to 1.28 while diluted (50%) showed lower activity indices that ranged from 0 to 0.63. The whole (exclusive) concentration of breast milk showed much higher antimicrobial effects on the DEC than the diluted (Tables 2 and 3).
Table (1):
Primers for species-specific identification of Escherichia coli and typing
Diarrheagenic Escherichia coli (DEC)17.

DEC Genes Primer Amplicon size (bp)
E. coli Alrgene CTGGAAGAGGCTAGCCTGGACGAG 366
AAAATCGGCACCGGTGGAGCGATC
ETEC sta ATTTTTCTTTCTGTATTGTCTT 180
CACCCGGTACAAGCAGGATT
EIEC ial CTGGTAGGTATGGTGAGG 320
CCAGGCCAACAATTATTTCC
EHEC hlyA GCATCATCAAGCGTACGTTCC 534
AATGAGCCAAGCTGGTTAAGCT

Table (2):
Zone of Inhibition of Breast Milk against Test Isolates 2 ETECs (1 and 2).

Undiluted Human Breast (Whole) 50 % Diluted Breast Milk Diameter of Standard Antibiotics (mm)
Sample codes Zone of Inhibition (mm) Activity Index Sample codes Zone of Inhibition (mm) Activity Index
UBM 1-01 12 0.67 DBM 1-01 10 0.56
UBM 1-02 18 1.00 DBM 1-02 10 0.56
UBM 1-03 14 0.78 DBM 1-03 6 0.33
UBM 1-04 16 0.89 DBM 1-04 7 0.38
UBM 1-05 14 0.78 DBM 1-05 6 0.33 18
UBM 1-06 18 1.00 DBM 1-06 8 0.44
UBM 1-07 11 0.61 DBM 1-07 9 0.50
UBM 1-08 16 0.89 DBM 1-08 8 0.44
UBM 1-09 15 0.82 DBM 1-09 10 0.56
UBM 1-10 17 0.94 DBM 1-10 9 0.50
UBM 2-01 18 1.13 DBM 1-01 0
UBM 2-02 17 1.06 DMB 2-02 0
UBM 2-03 15 0.93 DMB 2-03 0
UBM 2-04 18 1.13 DMB 2-04 0
UBM 2-05 15 0.93 DMB 2-05 0 16
UBM 2-06 16 1.00 DMB 2-06 9 0.56
UBM 2-07 11 0.68 DMB 2-07 10 0.63
UBM 2-08 12 0.75 DMB 2-08 7 0.44
UBM 2-09 18 1.13 DMB 2-09 6 0.37
UBM 2-10 12 0.75 DMB 2-10 10 0.63

Table (3):
Zone of Inhibition of Breast Milk against EIEC (3) and EHEC (4).

Undiluted Human Breast (Whole) 50 % Diluted Breast Milk Diameter of Standard Antibiotics (mm)
Sample codes Zone of Inhibition (mm) Activity Index Sample codes Zone of Inhibition (mm) Activity Index
UBM 3-01 11 0.73 DBM 3-01 8 0.53
UBM 3-02 12 0.80 DBM 3-02 0
UBM 3-03 16 1.06 DBM 3-03 0
UBM 3-04 14 0.93 DBM 3-04 8 0.53
UBM 3-05 13 0.86 DBM 3-05 9 0.60 15
UBM 3-06 14 0.93 DBM 3-06 8 0.53
UBM 3-07 17 1.13 DBM 3-07 0
UBM 3-08 18 1.20 DBM 3-08 9 0.60
UBM 3-09 16 1.06 DBM 3-09 7 0.46
UBM 3-10 13 0.86 DBM 3-10 8 0.53
UBM 4-01 18 1.13 DBM 3-01 8 0.44
UBM 4-02 12 0.75 DMB 4-02 10 0.56
UBM 4-03 16 1.00 DMB 4-03 0
UBM 4-04 17 1.06 DMB 4-04 0
UBM 4-05 15 0.93 DMB 4-05 6 0.33
UBM 4-06 15 0.93 DMB 4-06 6 0.33 16
UBM 4-07 17 1.06 DMB 4-07 0
UBM 4-08 14 0.87 DMB 4-08 0
UBM 4-09 13 0.81 DMB 4-09 7 0.44
UBM 4-10 18 1.13 DMB 4-10 0

None of the sterility plates for the breast milk samples showed any growth of potential pathogen, but very scanty colonies of Lactic Acid Bacteria (LAB). The test isolates, E. coli exhibited resistance (percentage resistance) to ciprofloxacin (25%), gentamycin (50%), augmentin (50%), penicillin (75%), cotrimoxazole (100%) and chloramphenicol (100%) (Table 4). Multidrug resistance was also observed among all the test isolates (Table 5). Two strains of ETEC showed different profile to conventional antibiotics and human breast milk. EC – 01 (ETEC) showed resistance to five antibiotics including penicillin, ofloxacin, augmentin, chloramphenicol, oxacillin, and cotrimoxazole in that order, while EC – 02 (ETEC) showed resistance to only four: ofloxacin, chloramphenicol, oxacillin and cotrimoxazole. EIEC and EHEC showed resistance to seven and eight antibiotics respectively.

Table (4):
Antibiotic Profile of the four DEC.

Isolates’ Code Antibiotics’ Profile
PN CEP CN OFL AU CHL CPX OX SXT
EC – 01 (ETEC) R S S R R R S R R
EC – 02 (ETEC) S I S R S R S R R
EC – 03 (EIEC) R R I R S R R R R
EC – 04 (EHEC) R R R R R R S R R

KEY: Penicillin (PC), Ceftazidime (CEP), Gentamycin (CN), Ofloxacin (OFL), Augmentin (AU), Chloramphenicol (CHL), Ciprofloxacin (CPX), Oxacillin (OX), Cotrimoxazole (SXT)
Table (5):
Multidrug Resistance Pattern.

Isolate’s code
Multidrug Resistance Pattern
EC – 01 (ETEC)
PN-OFL-AU-CHL-0X-SXT
EC – 02 (ETEC)
OFL-CHL-OX-SXT
EC – 03 (EIEC)
PN-CEP-OFL-CHL-CPX-OX-SXT
EC – 04 (EHEC)
PN-CEP-CN-OFL-AU-CHL-OX-SXT
DISCUSSION

The observed antibacterial activities of human breast milk on DEC from diarrheal patients explains the reason why it is still the preferred prophylaxis for infantile diarrhoea (Lorget et al., 2002). It is also in line with the reports of Berkhout et al. (2003) that the human milk contain antibacterial effect but the quality depends on the human health. This probably explains the reason why few breast milk samples here showed no activity.

Higher antibacterial activity than ofloxacin on some multidrug resistant test (DEC) isolates gives further credence to the place of breast feeding in appropriate motherhood, irrespective of civilization. The higher antibacterial effects in whole breast milk than 50 % concentration is in agreement with retrospective observation of Berkhout et al.21. This is evident in the activity indices that ranged from 0.61 to 1.28 to whole concentration compared to 0 to 0.63 for 50 % concentration. This difference was statistically significant (p < 0.01) and it gives a perspective voice in support of advocacy for exclusive breast feeding22, 23.

While human breast milk is expected as the ideal food for the new born during the first six months of life, it effect will be pronounced if it is exclusively without adding water. This is because of complete nutrition, early protection against illness, safe and healthy food are guaranteed in it 24. Igumbor et al.25 observed that freshly expressed human milk may increase the microbial flora of the neonate and these non-pathogenic microbial flora compete favourably with pathogenic diarrheagenic E. coli. This might be the reason for the presence of very scanty colonies of Lactic Acid Bacteria (LAB) in the human breast milk when it was tested for sterility.

Earlier studies from milk establishes two main classical mechanisms for immunological protection in form of IgA, IgG, IgM and other antimicrobial ligands26. High natural adaptiveness to the intestinal mucosal sites where they act and to the sharp changes in pH around the gut (due to ptyalin in saliva, acid in stomach, pancreatic juice /bile salt that sharply changes acidity to alkalinity in duodenum etc), unlike some conventional antibiotics whose metabolisms are partly affected by these biochemical dynamics27.

CONCLUSION

Whole (exclusive) concentration of breast milk showed higher antimicrobial effects on the multiple antibiotic resistant Diarrheagenic Escherichia coli than the 50% diluted concentration. The effect compares more favourably than few conventional antibiotics. This reiterates the need for exclusive breast feeding for safe motherhood, to prevent infantile diarrhea.

References
  1. Oddy, W.H. The Impact of Breast Milk on Infant and Child Health. Breastfed Rev., 2002; 10(3): 5-18.
  2. Bernt, K.M. and Walker, W.A. Human Milk as a Carrier of Biochemical Messages. Acta. Pediatr. Scand. Suppl., 1999; 88: 27-41.
  3. Ogra, P.L., Rassin, D.K. and Garofelo, R.P. Human Milk. Infect Dis Fetus and Newborn Infant, 2006; 2: 211-243.
  4. Goldfarb, J. Breastfeeding; AIDS and Other Infectious Diseases. Clin. Perinatol., 1993; 20: 225-243.
  5. Arnold, L.D. and Tully, M.R. Guidelines for the Establishment and Operation of a Human Milk Bank. West Hartford. Hum Milk Banking, 1991; 13: 242-253.
  6. Cao, V., Lambert, T., Nhu, D.Q., Loan, H.K., Hoang, N.K., Arlet, G., Courvalin, P. Distribution of extended-spectrum beta-lactamases in clinical isolates of Enterobacteriaceae in Vietnam. Antimicrob. Agents Chemother., 2002; 46: 3739-3743.
  7. Isenbarger, D.W., Hoge, A., Srijan, C., Pitarangsi, N., Vithayasai, L., Bodhidatta, K.W., Hickey, C.W., Cam, P.D. Comparative antibiotic resistance of diarrheal pathogens from Vietnam and Thailand, 1996-1999. Emerg. Infect. Dis., 2002; 8: 175-180.
  8. Boru, W.G., Kikuvi, G., Omollo, J., Abade, A., Amwayi, S., Ampofo, W., Luman, E.T., Oundo, J. Aetiology and factors associated with bacterial diarrhoeal diseases amongst urban refugee children in Eastleigh, Kenya: A case control study. Afr. J. Lab. Med., 2013; 2(1): 63.
  9. Fischer-Walker, C.L., Perin, J., Aryee, M.J., Boschi-Pinto, C. and Black, R.E. Diarrhea incidence in low- and middle-income countries in 1990 and 2010: a systematic review. BMC Pub Health, 2012; 12: 220.
  10. Mellies, J.L., Barron, A.M.S. and Carmona, A.M. Enteropathogenic and Enterohemorrhagic Escherichia coli Virulence Gene Regulation. Infect. Immun. 2007; 75(9): 199-4210.
  11. Branswell, H. A Nevada woman dies of a superbug resistant to every available antibiotic in the US. 2017; https://www.statnews.com/2017/01/12/nevada-woman-superbug-resistant/
  12. World Health Organization (WHO). WHO publishes list of bacteria for which new antibiotics are urgently needed. 2017; http://www.who.int/mediacentre/news/releases/ 2017/bacteria-antibiotics-needed/en/
  13. Goldman, J.A., Kearns, G.L. Fluoroquinolone Use in Paediatrics: Focus on Safety and Place in Therapy. 2011; 18th Expert Committee on the Selection and Use of Essential Medicines. http://www.who.int/selection_medicines/committees/expert/18/applicat-ions /fluoroquinolone_review.pdf
  14. Adefurin, A., Sammons, H., Jacqz-Aigrain, E., Choonara, I. Ciprofl oxacin safety in paediatrics: a systematic review. Downloaded from http://adc.bmj.com/ on April 12, 2017 – Published by group.bmj.com
  15. Choi, S.H., Kim, E.Y. and Kim, Y.J. Systemic use of fluoroquinolone in children. Korean J Pediatr. 2013; 56: 196–201. doi: 10.3345/kjp.2013.56.5.196.
  16. Zhou, Q., Younger, K.M. and Kearney, J.M. An exploration of the knowledge and attitudes towards breastfeeding among a sample of Chinese mothers in Ireland. BMC Pub Health. 2010; 10: 722.
  17. Adegoke, A.A., Aiyegoro, O.A. and Stenstrom, T.A. Interaction of methanolic extracts of Spondias mombin (linn) and amoxicillin on some diarrheagenic Escherichia coli (DEC). Trop. J. Microbiol.. 2016; 15(3):475-480.
  18. CLSI, Clinical and Laboratory Standards Institute. Performance Standards for Antimicrobial Susceptibility Testing, 21st Informational Supplement. CLSI Document 2011; M100-S21. Clinical and Laboratory Standards Institute, Wayne.
  19. BSAC. Methods for Antimicrobial Susceptibility Testing, Version 13 June 2014. 2014; http://bsac.org.uk/wp-content/uploads/2014/06/BSAC-disc-susceptibility-testing-method-June-2014.pdf
  20. Perez, C., Pauli, M. and Bazevque, P. An antibiotic assay by the agar well diffusion method. Acta Biol Med Exp., 1990; 15: 113-115.
  21. Berkhout, B., Floris, R., Recio, I. and Visser, S. Antibacterial effect of the milk protein lactoferrin. Agro Food Indu HiTech., 2003;14: 32-33.
  22. Mahmoud, N.A., Megahed, N.M. and Mona, M.E. Assessment of Knowledge and Practice of Proper Breastfeeding among Mothers Attending- El-ShohadaPrimary Health Care Units, Ismailia City. Int. J. Healthcare Sci., 2011; 2(1): 70-78.
  23. UNICEF. Exclusive breastfeeding protects newborns from HIV/AIDS. 2014; downloaded on http://www.unicef.org/esaro/5440_zimbabwe2014_exclusive-breastfeeding.html
  24. Tomita, M., Takase, M. and Wakabayashi, H. Antimicrobial peptides of lactoferrin. Adv. Exp. Med. Biol., 1994; 357: 209.
  25. Igumbor, E.O., Makura, R.D., Makandirainba, B. and Chihots, V. Storage of Breast milk: Effect of temperature and storage duration on microbial growth. Cent Afr J Med., 2009; 46(9): 247–251.
  26. Hurley, W.L. and Theil, P.K. Perspectives on immunoglobulins in colostrum and milk. Nutrients. 2011; 3(4):442–474.
  27. Stevens, C.R., Miller, T.M., Clinch, J.G., Kanezler, J.M., Bodamyali, T. and Blake, D.R. Antibacterial properties of xanthine oxidase in human milk. Lancet, 2000; 356: 829–830.

Article Metrics

Article View: 5823

Share This Article

© The Author(s) 2017. Open Access. This article is distributed under the terms of the Creative Commons Attribution 4.0 International License which permits unrestricted use, sharing, distribution, and reproduction in any medium, provided you give appropriate credit to the original author(s) and the source, provide a link to the Creative Commons license, and indicate if changes were made.